"AMPLICON RECONBINANT DNA Molecule, DNA Probe, DNA Molecule Pair METHOD FOR DETECTING THE PRESEN

专利摘要:
mon 87427 transgenic maize event and the relative development range. the invention provides the mon 87427 transgenic maize wind and the plants, plant cells, seeds, plant parts and commodities derived from the mon 87427 event. the invention also provides nucleotides specific for the mon 87427 event. mon 87427 transgenic maize and the plants, plant cells, seeds, plant parts and commodities comprising the nucleotides specifically for the mon 87427 transgenic maize event. the invention also provides methods related to the event mon corn 87427 and the roundup hybridization system (rhs). The invention also provides a relative developmental range useful for monitoring and determining reproductive development in maize that identifies reproductive development differences in maize. This is useful for determining the most favorable timing of a treatment regimen where the pension development stage is an important factor, including various hybrid seed production methods.
公开号:BR112012012404B1
申请号:R112012012404-8
申请日:2010-11-16
公开日:2019-03-06
发明作者:Paul C. C. Feng；Agustin E. Fonseca；Carl W. Garnaat；Oscar Heredia；Jintai Huang；Rebecca A. Kelly；Youlin Qi；Martin A. Stoecker
申请人:Monsanto Technology Llc；
IPC主号:

专利说明:

Invention Patent Description Report for AMPLICON RECOMBINANT DNA MOLECULE, DNA PROBE, DNA MOLECULE PAIR, METHOD FOR DETECTING THE PRESENCE OF A DNA MOLECULE AND DNA DETECTION KIT.
REMISSIVE REFERENCE TO RELATED APPLICATIONS [001] This application claims the benefit of Provisional US Patent Application No. 61 / 263,526 filed on November 23, 2009, which is hereby incorporated by reference in its entirety into the present invention, and from Provisional North American Patent Application No. 61 / 263,530, filed on November 23, 2009, which is hereby incorporated by reference in its entirety into the present invention.
SEQUENCE LIST INCORPORATION [002] The sequence listing that is contained in the file named 56887-0001_seqlisting.txt, which is 19.6 kilobytes (size as measured in Microsoft Windows®) and was created on November 12, 2010, it is deposited here by electronic presentation and is hereby incorporated by reference in its entirety in the present invention.
FIELD OF THE INVENTION [003] The invention refers to the fields of production, research and agriculture of plants. More specifically, it refers to the MON 87427 transgenic corn event and nucleotide molecules, plants, plant parts, seeds, cells, agricultural products and methods related to the MON 87427 transgenic corn event. it refers to the development of forecasting of the corn tassel and its use in methods for the production, research and agriculture of plants and to the hybrid corn seed produced in this way.
Petition 870180065559, of 07/30/2018, p. 6/98
2/84
BACKGROUND OF THE INVENTION [004] Crops that have new and desirable traits are useful for the production and research of plants and also for agricultural purposes. Such cultures can be produced using biotechnology methods. However, the production and selection of a commercially appropriate transgenic event may require extensive research, analysis and characterization of a large number of transformation events for an individual plant in order to select an event that has the desirable trait and phenotypic characteristics more favorable agricultural and agricultural resources needed to make it suitable for commercial and agricultural purposes. This event selection process often requires greenhouse and field experiments with many events over many years, in multiple positions and under a variety of conditions, so that a significant amount of agronomic, phenotypic and molecular data can be collected. The resulting data and observations must then be analyzed by teams of scientists and agronomists in order to select a commercially appropriate event. The invention provides such a commercially appropriate event, resulting in a new and desirable trait in corn.
[005] The exact determination of the reproductive maturity of corn is also useful for the production and research of the plant and also for agricultural purposes, as in the production of hybrid corn seed. The tools generally used in the state of the art of forecasting and estimating the growth and development stages of corn include ranges such as Stages V, which are based on vegetative characteristics, and Growing Units, which are based on the number of days increasing degree. However, both tools produce tassel developmental stage estimates that vary significantly across corn genotypes. Con
Petition 870180065559, of 07/30/2018, p. 7/98
3/84 relying on these measures can thus create a risk of missing the most favorable moment for treatment regimens where the stage of development is an important factor. The invention provides a Relative Development Range based on the development of the tassel identified through the genotypes, which is useful for monitoring and forecasting the tassel in maize through the various genotypes.
BRIEF DESCRIPTION OF THE INVENTION [006] The invention provides a recombinant DNA molecule that comprises a nucleic acid molecule, which comprises a nucleotide sequence selected from the group consisting of SEQ ID NO .: 1-8. The invention also provides a recombinant DNA molecule formed by joining a heterologous inserted nucleic acid molecule and genomic DNA from a corn plant, a plant cell or a seed. The invention also provides a recombinant DNA molecule derived from the MON 87427 transgenic corn event, a representative sample of the seed that was deposited with the American Type Culture Collection (ATCC®) under the No. Access Code PTA7899. The invention also provides a recombinant DNA molecule that is an amplified fragment diagnosis for the presence of DNA derived from the MON 87427 transgenic corn event. The invention also provides a recombinant DNA molecule that is found in a corn plant, in a plant cell, seed, progeny plant, plant part or commodity product derived from MON 87427 transgenic corn event.
[007] The invention also provides a DNA molecule that comprises a nucleic acid molecule that has a nucleotide sequence of sufficient length from the contiguous nucleotide sequence of SEQ ID NO .: 10 that functions as a DNA probe that is hybridized under strict hybridization conditions with one molecule
Petition 870180065559, of 07/30/2018, p. 8/98
4/84 DNA that comprises a nucleotide sequence selected from the group consisting of SEQ ID NO .: 1-10 and is not hybridized under strict hybridization conditions to a DNA molecule that does not comprise a nucleotide sequence selected from group consisting of SEQ ID NO .: 1-10.
[008] The invention also provides a pair of DNA molecules that consist of a first DNA molecule and a second DNA molecule different from the first DNA molecule, where each between the first and the second DNA molecule comprises a molecule nucleic acid that has a nucleotide sequence of sufficient length of contiguous nucleotides of SEQ ID NO .: 10 that functions as DNA primers when used together in an amplification reaction with the DNA derived from the MON 87427 event to produce a diagnosis of the amplified fragment for MON 87427 transgenic corn event DNA in one sample.
[009] The invention also provides a method for detecting the presence of a DNA molecule derived from MON 87427 in a sample that comes into contact with a sample with the DNA probe, subjecting the sample and the DNA probe to hybridization conditions and detecting hybridization of the DNA probe to a DNA molecule in the sample, where hybridization of the DNA probe to the DNA molecule indicates the presence of a DNA molecule derived from the MON 87427 transgenic corn event in the sample.
[0010] The invention also provides a method to detect the presence of a DNA molecule derived from the MON 87427 transgenic corn event in a sample that comes in contact with a sample with the pair of DNA molecules, to perform a sufficient amplification reaction to produce an amplified DNA fragment comprising a sequence selected from the group consisting of SEQ ID NO .: 1-10 and detecting the presence of the amplified fragment of the
Petition 870180065559, of 07/30/2018, p. 9/98
5/84
DNA in the reaction, in which the presence of the amplified DNA fragment in the reaction indicates the presence of a DNA molecule derived from MON 87427 in the sample.
[0011] The invention also provides a DNA detection kit that comprises at least one DNA molecule that comprises a nucleotide sequence of sufficient length from the contiguous nucleotide sequence of SEQ ID NO .: 10 that functions as a DNA primer or specific probe to detect the presence of DNA derived from the MON 87427 transgenic corn event, where DNA detection is a diagnosis of the presence of the DNA from the MON 87427 transgenic corn event in a sample.
[0012] The invention also provides a corn plant, seed, cell or recombinant plant part thereof comprising a nucleic acid molecule that has a nucleotide sequence selected from the group consisting of SEQ ID NO .: ΙΙΟ. The invention also provides a corn plant, a seed, a cell or a part of a recombinant plant that has a selective tissue tolerance to treatment with the glyphosate herbicide. The invention also provides a corn plant, a seed, a cell or a part of a recombinant plant, whose genome produces an amplified fragment that comprises a DNA molecule selected from the group consisting of SEQ ID NO .: 1-10 when tested in a DNA amplification method.
[0013] The invention also provides a corn or seed plant, in which the corn plant or seed is derived from the MON 87427 transgenic corn event. The invention also provides a corn or seed plant, in which the corn plant or the seed is a hybrid that has at least one parent derived from the MON 87427 transgenic corn event.
[0014] The invention also provides an inanimate plant material
Petition 870180065559, of 07/30/2018, p. 10/98
6/84 comprising a recombinant DNA molecule selected from the group consisting of SEQ ID NO .: 1-10.
[0015] The invention also provides a microorganism that comprises a nucleic acid molecule that has a nucleotide sequence selected from the group consisting of SEQ ID NO .: 1-10. The invention also provides a microorganism that is a plant cell. [0016] The invention also provides a commodity product produced from the MON 87427 transgenic corn event and which comprises a nucleic acid molecule that has a nucleotide sequence selected from the group consisting of SEQ ID NO .: 1-10 , in which the detection of a nucleotide sequence in a sample derived from a commodity product determines that the commodity product was produced from the MON 87427 transgenic corn event. The invention also provides a commodity product selected from the group consisting of in whole or processed seeds, animal feed, oil, coarse flour, fine flour, flakes, bran, biomass and combustible products. The invention also provides a method for producing a commodity product to obtain a corn plant or a part thereof comprising the MON 87427 transgenic corn event and producing a corn commodity product from the corn plant or part thereof .
[0017] The invention also provides a method for controlling weeds in a field by planting MON 87427 plants in a field and applying an effective dose of glyphosate herbicide to control weeds in the field without damaging plants from the MON transgenic corn event. 87427. The invention also provides a method for controlling weeds in a field, where the effective dose of the glyphosate herbicide is about 0.112 kg to about 4.48 kg per hectare (about 0.1 pound to about 4 pounds per acre).
[0018] The invention also provides a method for producing a
Petition 870180065559, of 07/30/2018, p. 11/98
7/84 corn plant that tolerates the application of the glyphosate herbicide when sexually crossing a MON 87427 transgenic corn event plant that comprises a nucleic acid molecule, which comprises a nucleotide sequence selected from the group consisting of SEQ ID NO. : 1-10 with a second corn plant, thereby producing the seed, collecting the seed produced from the cross, growing the seed to produce a plurality of progeny plants, treating the progeny plants with glyphosate and selecting a plant from progeny that is tolerant to glyphosate. The invention also provides a method for producing a corn plant that tolerates the application of the herbicide glyphosate by individualizing a MON 87427 transgenic corn event plant that comprises a nucleic acid molecule, which comprises a nucleotide sequence selected from the group consisting of the SEQ ID NO .: 1-10, thereby producing the seed, collecting the seed produced by individualizing, growing the seed to produce a plurality of progeny plants, treating the progeny plants with glyphosate and selecting a progeny plant that is tolerant to glyphosate.
[0019] The invention also provides a method for producing hybrid corn seed by planting the MON 87427 transgenic corn event seed in an area, growing a corn plant from seed, treating the plant with an effective dose of the glyphosate herbicide before pollen formation to make the male plant sterile without damaging the plant, fertilize the plant with pollen from a second parent plant and harvest the seed from the plant, where the seed is the hybrid maize seed produced by crossing plants in the MON 87427 transgenic corn event with a second parent plant. The invention also provides a method for producing hybrid corn seed, in which the effective dose of the glyphosate herbicide is about 0.112 kg to about 4.48 kg per hectare (about 0.1 pound to about 4 pounds per acre).
Petition 870180065559, of 07/30/2018, p. 12/98
8/84
The invention also provides a method for producing the hybrid corn seed, which additionally includes planting a second seed of the parent plant in the area and growing a corn plant from the second parent plant. The invention also provides a method for producing hybrid corn seed, in which the second parent plant is tolerant to glyphosate.
[0020] The invention also provides a method for predicting the timing of development of the corn tassel when selecting a range in a Relative Development Range, where the range indicates maturation at a desired stage of development of the tassel. The invention also provides a method for predicting the timing of development of the tassel of corn, in which the desired stage of development of the tassel is the stage of development of the tassel most favorable for reproductive crossing, sterilization of the tassel, stripping and / or the administration of a treatment for the modulation of development for a corn plant. The invention also provides a method for predicting the developmental timing of the corn tassel, in which the specific flower development stage used to build the Relative Development Strip is in the pollen release for about 50 percent of a plant population of corn and where the range is between about 0.62 and about 0.75 in the Relative Development Range. The invention also provides a method for predicting the developmental timing of the corn tassel, additionally including administering a treatment for modulating development to a corn plant at the desired stage of tassel development.
[0021] The invention also provides a method for producing hybrid corn seed by planting corn seed for a first parent plant in an area, growing the first corn seed parent plant, determining the timing of development of the
Petition 870180065559, of 07/30/2018, p. 13/98
9/84 tassel for the first parent plant when selecting a band that indicates maturation to a desired stage of tassel development in a Relative Development Band, use the determination of the tassel's development timing to timely administer a treatment for modulating the tassel development to the first parent plant thereby preventing the self-fertilization of the first parent plant, administering the treatment to modulate development to the first parent plant, fertilizing the first parent plant with pollen from a second parent plant and harvesting the seed of the first parent plant , where the seed is the hybrid maize seed produced by crossing the first parent plant with the second parent plant. The invention also provides the hybrid maize seed produced using the method. The invention also provides a method for producing hybrid maize seed, where the treatment for developmental modulation is glyphosate and the first parent plant has a tissue selective glyphosate tolerance. The invention also provides a method for producing hybrid corn seed, wherein the first parent plant is a MON 87427 transgenic corn event plant. The invention also provides a method for producing hybrid corn seed, wherein the second plant parent is tolerant to glyphosate.
[0022] The above and still other aspects of the invention will become more evident from the detailed description below.
BRIEF DESCRIPTION OF THE DRAWINGS [0023] Figure 1 illustrates the organization of the MON 87427 transgenic corn event. In the figure, [A1], [A2] and [A3] correspond to the relative position of SEQ ID NO .: 1, SEQ ID NO .: 3. and SEQ ID NO .: 5, respectively, which pass through the genomic DNA of corn that flanks the 5 'end of the transgene insert and the 5' portion of the DNA of the transgene insert; [B1], [B2] and [B3] correspond to the relative position of SEQ
Petition 870180065559, of 07/30/2018, p. 14/98
10/84
ID NO .: 2, SEQ ID NO .: 4. and SEQ ID NO .: 6, respectively, that pass through the genomic DNA of corn that flanks the 3 'end of the transgene insert and the 3' portion of the DNA insertion of the transgene; [C] corresponds to the relative position of SEQ ID NO .: 7, which includes the genomic DNA from corn that flanks the 5 'end of the transgene insert and a portion of the 5' end of the transgene insert; [D] corresponds to the relative position of SEQ ID NO .: 8, which includes the genomic DNA from corn flanking the 3 'end of the transgene insert and a portion of the 3' end of the transgene insert; [E] corresponds to the relative position of SEQ ID NO .: 9 and the various elements in the insertion of the transgene; and [F] represents the contiguous sequence of MON 87427 provided as SEQ ID NO .: 10 and comprises SEQ ID NO .: 1-9.
[0024] Figure 2 shows the seed yield of MON 87427 hybrids when crossed with the NK603 corn event and sprinkled twice per season with glyphosate at a rate of 2.52 kg per hectare (2.25 pounds per acre) ) each sprinkler.
[0025] Figure 3 illustrates the tassel development stages used to build the Relative Development Range. The approximate size is shown in parentheses. In the figure, Vg is the meristem in the vegetative stage; T0 is the change from vegetative to reproductive; T1 is the visible growing reproductive point (0.9 mm); T2 are the beginning of visible lateral branching (1.8 mm); T3 are the beginning of the spikelet visible (4.1 mm); T4 is the elongation of the central axis and the lateral axis (12.9 mm); T5 is the beginning of anther differentiation (41.0 mm); T6 is the beginning of pollen differentiation (175 mm); and T7 is the manifestation of the anther and the release of pollen (285.0 mm).
[0026] Figure 4 illustrates a variation in the size of the tassel between three maize genotypes in two developmental stages (V8 and V10). [0027] Figure 5 illustrates the correlation between GDU requirements
Petition 870180065559, of 07/30/2018, p. 15/98
11/84 for Stage T5 and those for P50% and more specifically shows the regression line produced when using the correlation between the GDU requirements for T5 and for P50%. Each point represents a different pure line, with its average calculated through the positions.
[0028] Figure 6 illustrates an example of how the Relative Development Strip reveals a more favorable window of effectiveness for the chemical agent to produce the sterility of the corn tassel, as measured by the risk of anther extrusion (AE risk (%) ) which occurs at 0.62 and 0.75 in the Relative Development Range, in which 62% -75% of the total GDU requirement to reach P50 is reached and where the AE Risk is minimized through the pure lines and maturity groups. Each data point represents values with their averages calculated for 1 lot, or two rows for a total of 32 plants. N = 620 [0029] Figure 7 illustrates stages T as a function of GDU (A) and the Relative Development Range (B). Each regression line represents a different pure line.
[0030] Figure 8 illustrates the percentage of anther extrusion risk (y-axis) measured at different spigot stages (x-axis) for MON 87427 and CMS blocks.
[0031] Figure 9 illustrates the genetic purity of the seed and the trace purity of the seed of the hybrid seed produced by MON 87427 with the Roundup® hybridization system (RHS) and the CMS system at the 95% significance level. The black line in the table represents the desired quality standards for the genetic purity of the seed and the trace purity of the seed, respectively.
BRIEF DESCRIPTION OF THE SEQUENCES [0032] SEQ ID NO .: 1 is a sequence of twenty nucleotides that represents the 5 'junction region of a corn genomic DNA and an integrated transgenic expression cassette.
[0033] SEQ ID NO .: 2 is a sequence of twenty nucleotides that
Petition 870180065559, of 07/30/2018, p. 16/98
12/84 represents the 3 'junction region of a corn genomic DNA and an integrated transgenic expression cassette.
[0034] SEQ ID NO .: 3 is a sequence of sixty nucleotides that represents the 5 'junction region of a corn genomic DNA and an integrated transgenic expression cassette.
[0035] SEQ ID NO .: 4 is a sequence of sixty nucleotides that represents the 3 'junction region of a corn genomic DNA and an integrated transgenic expression cassette.
[0036] SEQ ID NO .: 5 is a sequence of one hundred nucleotides that represents the 5 'junction region of a corn genomic DNA and an integrated transgenic expression cassette.
[0037] SEQ ID NO .: 6 is a 100 nucleotide sequence that represents the 3 'junction region of a corn genomic DNA and an integrated transgenic expression cassette.
[0038] SEQ ID NO .: 7 is the 5 'sequence that flanks the inserted DNA from MON 87427 up to and including a DNA insertion region of the transgene.
[0039] SEQ ID NO .: 8 is the 3 'sequence that flanks the inserted DNA from MON 87427 up to and including a DNA insertion region of the transgene.
[0040] SEQ ID NO .: 9 is the sequence entirely integrated into the genomic DNA of corn and which contains the expression cassette DNA. [0041] SEQ ID NO .: 10 is the nucleotide sequence that represents the contiguity of the 5 'sequence that flanks the inserted DNA of MON 87427 (SEQ ID NO .: 7), the sequence entirely integrated into the genomic DNA of corn and which contains the expression cassette (SEQ ID NO .: 9), and the 3 'sequence flanking the inserted DNA of MON 87427 (SEQ ID NO .: 8) and includes SEQ ID NO .: 1 -6.
[0042] SEQ ID NO .: 11 is the specific Primer transgene assay
Petition 870180065559, of 07/30/2018, p. 17/98
13/84 of Event 1 SQ20052 used to identify MON 87427. An amplified PCR fragment produced from a TAQMAN® assay (PE Applied Biosystems, Foster City, CA) when using the primer combination of SEQ ID NO .: 11 and SEQ ID NO .: 12 is a positive result for the presence of the MON 87427 event.
[0043] SEQ ID NO .: 12 is a specific assay of Event 1 Primer transgene SQ20053 used to identify MON 87427.
[0044] SEQ ID NO .: 13 is a PB10016 Event 6-FAM transgene specific assay used to identify MON 87427. This probe is a synthetic oligonucleotide labeled 6FAM ^TM . The release of a fluorescent signal in an amplification reaction when using SEQ ID NO .: 11-12 primers in combination with the probe labeled 6FAM ^TM is the diagnosis of the MON 87427 event in a TAQMAN® assay.
[0045] SEQ ID NO .: 14 is a specific transgene assay for Internal Control Primer 1 SQ1241.
[0046] SEQ ID NO .: 15 is a specific transgene assay for Internal Control Primer 1 SQ1242.
[0047] SEQ ID NO .: 16 is a specific transgene assay for VIC Internal Control Probe PB0084.
[0048] SEQ ID NO .: 17 is an event specific assay for Event Primer 1 SQ12763 used to identify MON 87427. An amplified PCR fragment produced from a TAQMAN ^® assay (PE Applied Biosystems, Foster City , CA) when using the primer combination of SEQ ID NO .: 17 and SEQ ID NO .: 18 is a positive result for the presence of the MON 87427 event.
[0049] SEQ ID NO .: 18 is an event specific test of Event Primer 1 SQ12886 used to identify MON 87427.
[0050] SEQ ID NO .: 19 is a specific transgene assay from Probe 6-FAM of Event PB4352 used to identify MON 87427.
Petition 870180065559, of 07/30/2018, p. 18/98
14/84
DETAILED DESCRIPTION [0051] The following definitions and methods are provided to further define the invention and to guide elements skilled in the art in the practice of the invention. Unless otherwise indicated, the terms must be understood according to conventional usage by the elements versed in the relevant technique.
[0052] As used in the present invention, the term corn means corn or Zea mays, and includes all plant varieties that can be produced with corn, including the wild corn species as well as those plants that belong to Zea that allow crossing between species.
[0053] Glyphosate refers to N-phosphonomethylglycine, which is a herbicide that is an inhibitor of enolpyruvylchiquime 3-phosphate synthase (EPSPS). Glyphosate interferes with the synthesis of aromatic amino acids by inhibiting EPSPS. Glyphosate is commercially available as the herbicide Roundup® (Monsanto Company, St. Louis, Missouri).
[0054] The invention provides the MON 87427 transgenic corn event (also referred to in the present invention as MON 87427). As used in the present invention, the term event refers to a product created by the act of inserting a transgenic nucleic acid molecule into the genome of a plant, that is, by the act of transforming the plant to produce a transgenic plant. An event is produced, therefore, by the human acts of: (i) transforming a plant cell into a laboratory with a nucleic acid molecule that includes a transgene of interest, that is, inserting the construction or structure into the genome of the plant cell. nucleic acid molecule, (ii) regenerating a population of transgenic plants resulting from the insertion of the nucleic acid molecule into the plant's genome and (iii) selecting a particular plant characterized by inserting the nucleic acid molecule into a position
Petition 870180065559, of 07/30/2018, p. 19/98
15/84 in the plant genome. The event can therefore be exceptional and specifically described by a nucleic acid sequence that represents at least a portion of the contiguous DNA molecule that was produced in the event by inserting the nucleic acid molecule at the particular position in the plant's genome and that includes a portion of the plant's own genomic DNA, which flanks and is physically connected to the inserted DNA molecule and the inserted nucleic acid molecule. An event is recombinant, produced by human actions and is not found in non-transgenic plants.
[0055] The term event thus refers to the original transformed plant (transformant), which includes the nucleic acid molecule inserted in the particular position in the plant's genome. The term event also refers to the entire progeny that descends from the transformant that includes the nucleic acid molecule inserted in the particular position in the plant's genome. Such a progeny is therefore transgenic and comprises the event. The progeny can be produced using any device, including self-fertilization, crossing with another plant comprising the same or a different transgene and / or crossing with a non-transgenic plant, such as one of a different variety. Even after many generations, in any plant called a MON 87427 progeny plant, the inserted DNA and the flanking DNA from the original transformed plant will be present and readily identifiable.
[0056] The term event also refers to the contiguous DNA molecule created in the original transformant (which comprises the inserted DNA and flanking corn genomic DNA immediately adjacent to either side of the inserted DNA) or any DNA molecule comprising that nucleic acid sequence. The contiguous DNA molecule was created by the act of introducing a nucleic acid molecule
Petition 870180065559, of 07/30/2018, p. 20/98
16/84 transgenic in the genome of a plant, that is, by the act of transformation, and is specific and exclusive to the particular event. The arrangement of the DNA inserted in MON 87427 with respect to the genomic DNA of the surrounding corn plant is therefore specific and exclusive to MON 87427. This DNA molecule is also an integral part of the MON 87427 corn chromosome and, as such, it is static in the plant and can be inherited by any progeny.
[0057] Plants from the MON 87427 transgenic corn event exhibit a commercially acceptable tissue selective glyphosate tolerance. In MON 87427, maize vegetative tissues and female maize reproductive tissues are tolerant to glyphosate, but the main male reproductive tissues of corn essential for the development of corn pollen are not tolerant to glyphosate. MON 87427 plants treated with glyphosate can therefore be used as a female parent in the production of hybrid seed.
[0058] As used in the present invention, the term recombinant refers to a DNA and / or a protein and / or an unnatural organism that is not normally found in nature and was created by human intervention, that is, by human hands. Such human intervention can produce a DNA molecule and / or a plant or a seed. As used in the present invention, a recombinant DNA molecule is a DNA molecule that comprises a combination of DNA molecules that would not naturally occur together, and is the result of human intervention, for example, a DNA molecule that is comprised of a combination of at least two DNA molecules heterologous to each other and / or a DNA molecule that is artificially synthesized and has a nucleotide sequence that deviates from the nucleotide sequence that would normally exist in nature and / or a DNA molecule that comprises a nucleic acid molecule artificially incorporated into a genomic DNA of the
Petition 870180065559, of 07/30/2018, p. 21/98
17/84 host cell and the associated flanking DNA of the host cell genome. An example of a recombinant DNA molecule is a DNA molecule that comprises at least one sequence selected from SEQ ID NO .: 1-10. As used in the present invention, a recombinant plant is a plant that does not normally exist in nature, is the result of human intervention, and contains a transgene and / or a heterologous DNA molecule incorporated into its genome. As a result of such a genomic change, the recombinant plant is distinctly different from the related wild-type plant. An example of a recombinant plant is a MON 87427 transgenic corn event plant.
[0059] As used in the present invention, the term transgene refers to a nucleic acid molecule artificially incorporated into an organism's genome as a result of human intervention. Such a transgene can be heterologous to the host cell. The term transgenic refers to the fact that it comprises a transgene, for example, a transgenic plant refers to a plant that comprises a transgene, that is, a nucleic acid molecule artificially incorporated into the organism's genome as a result of human intervention. As used in the present invention, the term heterologous refers to a first molecule not normally found in nature in combination with a second molecule normally found in nature. For example, a molecule can be derived from a first species and be inserted into the genome of a second species. The molecule would thus be a heterologous molecule, that is, heterologous to the organism and artificially incorporated into the organism's genome.
[0060] As used in the present invention, the term chimeric refers to a single DNA molecule produced by fusing a first DNA molecule to a second DNA molecule, where neither the
Petition 870180065559, of 07/30/2018, p. 22/98
18/84 neither the first nor the second DNA molecule is normally found in this configuration, that is, one fused to the other. The chimeric DNA molecule is thus a new DNA molecule that would not otherwise be found normally in nature. An example of a chimeric DNA molecule is a DNA molecule that comprises at least one sequence selected from SEQ ID NO .: 1-10.
[0061] The invention provides DNA molecules and their corresponding nucleotide sequences. As used in the present invention, the term DNA, DNA molecule, nucleic acid molecule refers to a double stranded DNA molecule of genomic or synthetic origin, that is, a deoxyribonucleotide or a nucleotide molecule-based polymer, read from the 5 'end (upstream) to the 3' end (downstream). As used in the present invention, the term DNA sequence or nucleotide sequence refers to the nucleotide sequence of a DNA molecule. The nomenclature used in the present invention is that required by Title 37 of the North American Code of Federal Regulations § 1.822 and is determined in the tables in Standard WIPO ST.25 (1998), Appendix 2, Tables 1 and 3. By convention and as used in the present invention, the nucleotide sequences of the invention, such as those provided as SEQ ID NO .: 1-10 and fragments thereof, are provided with reference to only one strand of the two complementary strands of the nucleotide sequence, but by implication, the complementary sequences (i.e., the complementary strand sequences), also referred to in the art as the reverse complementary sequences, are within the scope of the invention and are expressly within the scope of the claimed subject. Thus, as used herein, references to SEQ ID NO .: 1-10 and fragments thereof
Petition 870180065559, of 07/30/2018, p. 23/98
19/84 include and refer to the sequence of the complementary cord and its fragments.
[0062] As used in the present invention, the term fragment refers to a portion of or to an incomplete minor part of a whole. For example, fragments of SEQ ID NO .: 10 would include sequences that are at least about 10 nucleotides, at least about 20 nucleotides, or at least about 50 nucleotides from the complete sequence of SEQ ID NO .: 10.
[0063] The nucleotide sequence that corresponds to the complete nucleotide sequence of the inserted transgenic DNA and the substantial segments of the corn genome DNA flanking either end of the inserted transgenic DNA is provided in the present invention as SEQ ID NO. : 10. A subsection of this is the inserted transgenic DNA (also referred to in the present invention as the insertion of the transgene or the inserted DNA) provided as SEQ ID NO .: 9. The nucleotide sequence of the genomically bound maize DNA by the phosphodiester binding link a and, therefore, flanking the 5 'end of the inserted transgenic DNA and containing 10 nucleotides of the inserted DNA of the transgene, is determined as shown in SEQ ID NO .: 7. The DNA nucleotide sequence of the maize genome physically linked by the phosphodiester binding link a and therefore flanking the 3 'end of the inserted transgenic DNA and containing 10 D nucleotides The inserted NA of the transgene is determined as shown in SEQ ID NO .: 8.
[0064] MON 87427 additionally comprises two regions called junctions. A junction is the place where an end of the inserted transgenic DNA was inserted and connected to the genomic DNA. A junction crosses, that is, extends transversely, a portion of the inserted transgenic DNA and the genomic DNA of flan
Petition 870180065559, of 07/30/2018, p. 24/98
20/84 adjacent plumbing and, as such, comprises the connection point of these two as a contiguous molecule. One junction is at the 5 'end of the inserted transgenic DNA and one is at the 3' end of the inserted transgenic DNA, referred to in the present invention as the 5 'junction and the 3' junction, respectively. A junction sequence or a junction region refers to the DNA sequence and / or the corresponding DNA molecule of the junction. The MON 87427 junction sequences can be designed by a person skilled in the art when using SEQ ID NO .: 10. Examples of MON 87427 junction sequences are provided as SEQ ID NO .: 1-6. SEQ ID NO .: 1 is a 20 nucleotide sequence that crosses the junction between the corn genomic DNA and the 5 'end of the transgenic insertion DNA; SEQ ID NO .: 3 is a 60 nucleotide sequence that crosses the junction between the corn genomic DNA and the 5 'end of the transgenic insert DNA; SEQ ID NO .: 5 is a 100 nucleotide sequence that crosses the junction between the corn genomic DNA and the 5 'end of the transgenic insert DNA. SEQ ID NO .: 2 is a 20 nucleotide sequence that crosses the junction between the corn genomic DNA and the 3 'end of the inserted DNA; SEQ ID NO .: 4 is a sequence of 60 nucleotides that crosses the junction between the corn genomic DNA and the 3 'end of the inserted DNA; SEQ ID NO .: 6 is a 100 nucleotide sequence that crosses the junction between the corn genomic DNA and the 3 'end of the inserted DNA. Figure 1 illustrates the physical arrangement of SEQ ID NO .: 1-10 arranged from 5 'to 3'. Any segment of DNA derived from transgenic MON 87427 that includes SEQ ID NO .: 1-6 is within the scope of the invention. The invention thus provides a DNA molecule that contains at least one of the nucleotide sequences, as indicated in SEQ ID NO: 1-6. [0065] MON 87427 event junction sequences are present as part of the genome of a plant, a seed or a
Petition 870180065559, of 07/30/2018, p. 25/98
21/84 a MON 87427 transgenic corn event cell. The identification of one or more of SEQ ID NO .: 1-6 in a sample derived from a corn plant, seed or plant part determines that the DNA was obtained from MON 87427 and is diagnostic for the presence in a MON 87427 DNA sample.
[0066] The invention provides exemplary DNA molecules that can be used as primers or probes for diagnosing the presence of DNA derived from the MON 87427 corn plant event in a sample. Such primers or probes are specific for a target nucleic acid sequence and, as such, are useful for the identification of MON 87427 nucleic acid sequences by the methods described in the present invention.
[0067] Primer is a nucleic acid molecule that is designed for use in annealing or hybridization methods that involve thermal amplification. A pair of primers can be used with a template DNA, such as a sample of genomic corn DNA, in thermal amplification, such as the polymerase chain reaction (PCR), to produce an amplified fragment, in which the fragment amplified produced from such a reaction has a DNA sequence corresponding to the template DNA sequence located between the two sites where the primers are hybridized to the template. As used in the present invention, an amplified fragment is the DNA that was synthesized when using the amplification techniques. The amplified fragments of the invention have a sequence comprising one or more of SEQ ID NO .: 1-10 or fragments thereof. A primer is typically designed to hybridize to a complementary target strand of DNA to form a hybrid between the primer and the target strand of DNA, and the presence of the primer is a point of recognition by a polymerase to initiate primer extension (ie is, the polymerization of
Petition 870180065559, of 07/30/2018, p. 26/98
22/84 additional nucleotides in a stretching nucleotide molecule) when using the target DNA strand as a template. Primer pairs, as used in the invention, refer to the use of two primers that link opposite strands of a double stranded nucleotide segment in order to linearly amplify the nucleotide segment between the targeted positions for attachment by the individual members of the pair of initiators. Examples of primer sequences are provided as SEQ ID NO .: 11-12, SEQ ID NO .: 14-15 and SEQ ID NO .: 17-18. The pair of primers within SEQ ID NO .: 14-15 and each of the pair of primers within SEQ ID NO .: 17-18 has a first DNA molecule and a second DNA molecule (which is different from first DNA molecule), both molecules having sufficient contiguous nucleotide length that function as DNA primers that, when used together in a DNA amplification reaction with MON 87427-derived template DNA, produce a diagnosis of the amplified fragment to the presence in a MON 87427 DNA sample.
[0068] A probe is a nucleic acid molecule that is complementary to a strand of a target nucleic acid for use in annealing or hybridization methods. The probes according to the invention include not only ribonucleic or deoxyribonucleic acids but also polyamides and other probe materials that specifically bind to a target DNA sequence, and the detection of such a link can be useful in diagnosis, discrimination, determination or in confirming the presence of that target DNA sequence in a particular sample. A probe can be attached to a conventional detectable reporter or labeling molecule, for example, a radioactive isotope, a ligand, a chemiluminescent agent or an enzyme. Examples of sequences useful as probes to detect MON 87427 are SEQ ID NO .: 1-2, SEQ ID NO: 13, SEQ ID NO .:
Petition 870180065559, of 07/30/2018, p. 27/98
23/84
16, SEQ ID NO: 19.
[0069] Methods for designing and using primers and probes are well known in the art and are described, for example, by Joseph Sambrook, molecular Cloning: A Laboratory Manual, third edition, Cold Spring Harbor Laboratory Press (2001) and Current Protocols in Molecular Biology, Wiley-Blackwell. DNA molecules that comprise fragments of SEQ ID NO .: 1-10 and are useful as primers and probes for detecting MON 87427 can be readily designed by an expert in the art for use as probes in hybridization detection methods, for example, the Southern transfer method.
[0070] The DNA molecules and corresponding nucleotide sequences provided in the present invention are therefore useful for, among other things, identifying MON 87427, selecting plant varieties or hybrids comprising MON 87427, detecting the presence of DNA derived from transgenic MON 87427 in a sample and monitor the samples for the presence and / or absence of MON 87427 or parts of plants derived from MON 87427.
[0071] The invention provides corn plants, progeny, seeds, plant cells, plant parts and basic products. These plants, progeny, seeds, plant cells, plant parts and commodities contain a detectable amount of a nucleotide of the invention, that is, such as a nucleic acid molecule comprising at least one of the sequences provided as SEQ ID No .: 1-10. The plants, progeny, seeds, plant cells and plant parts of the invention can also contain one or more additional transgenes. Such transgenes can be any nucleotide sequence that encodes a protein or an RNA molecule that confers a desirable trait that includes, but is not limited to, increased resistance to insects, efficiency
Petition 870180065559, of 07/30/2018, p. 28/98
24/84 increased water use, increased yield performance, increased drought resistance, increased seed quality, increased nutritional quality and / or increased herbicide tolerance, where the desirable trait is measured with respect to a corn plant that has no such additional transgene.
[0072] The invention provides corn plants, progeny, seeds, plant cells and parts of plants and leaves derived from a MON 87427 transgenic corn plant event. A representative sample of the MON 87427 seed was deposited in accordance with the Treaty Budapest in order to make the invention possible. The repository selected to receive the deposit is the American Type Culture Collection (ATCC), which has 10801 University Boulevard, Manassas, Virginia USA, Postal Code 20110 as its address. The ATCC repository has assigned the No. of Access PTA-7899 to the seed of event MON 87427.
[0073] The invention provides a microorganism that comprises a DNA molecule that has SEQ ID NO .: 1-10 present in its genome. An example of such a microorganism is a transgenic plant cell. Microorganisms, such as a plant cell of the invention, are useful in many industrial applications, including, but not limited to: (i) use as a research tool for scientific inquiry or industrial research; (ii) use in culture to produce a carbohydrate, lipid, endogenous or recombinant nucleic acid, or protein products or small molecules that can be used for subsequent scientific research or as industrial products; and (iii) the use with modern plant tissue culture techniques to produce plants or transgenic plant tissue cultures that can then be used for agricultural research or production. The production and use of microorganisms such as transgenic plant cells employ modern microbiological techniques and human intervention to produce a synthetic microorganism and
Petition 870180065559, of 07/30/2018, p. 29/98
Exclusive 25/84. In this process, recombinant DNA is inserted into a plant cell genome to create a transgenic plant cell that is separate and unique from natural plant cells. This transgenic plant cell can then be grown, as well as bacteria and yeast cells, using modern microbiology techniques, and can exist in a single-celled, undifferentiated state. The genetic composition and phenotype of the new plant cell are a technical effect created by the integration of heterologous DNA into the cell's genome. Another aspect of the invention is a method for using a microorganism of the invention. Methods of using microorganisms of the invention, such as transgenic plant cells, include (i) methods for producing transgenic cells by integrating the recombinant DNA into the cell's genome and then using this cell to derive additional cells that have the same heterologous DNA; (ii) methods for culturing cells that contain recombinant DNA using modern microbiology techniques; (iii) methods for producing and purifying carbohydrate, lipid, endogenous or recombinant nucleic acid, or protein products from cultured cells; and (iv) methods for using modern plant tissue culture techniques with transgenic plant cells to produce transgenic plants or transgenic plant tissue cultures.
[0074] The plants of the invention can pass along the DNA of the event, including the insertion of the transgene, to the progeny. As used in the present invention, the progeny includes any plant, seed, plant cell and / or regenerable part of the plant that comprises the event DNA derived from an ancestor plant and / or a nucleic acid molecule that has at least one of the strings provided as SEQ ID NO .: 1-10. Plants, progeny and seeds can be homozygous or heterozygous for the transgene. The progeny can grow from the seeds produced by a
Petition 870180065559, of 07/30/2018, p. 30/98
26/84 MON 87427 plant and / or seeds produced by a plant fertilized with pollen from a MON 87427 plant. The plants of the invention can be produced by self-pollination or cross-pollination and / or can be used in self-pollination methods or cross-pollination. Thus, in one embodiment, a MON 87427 plant can be cross-pollinated by a different corn plant to produce hybrid offspring. Useful production methods with MON 87427 maize plants are known in the art.
[0075] The invention provides a plant part that is derived from MON 87427. As used in the present invention, a plant part refers to any part of a plant that is comprised of material derived from a MON 87427 plant. Plant parts include, but are not limited to, pollen, egg, pod, flower, root or stem tissue, fibers and leaves. Plant parts can be viable, non-viable, regenerable and / or non-regenerable.
[0076] The invention provides a commodity product that is produced from the MON 87427 transgenic corn event and comprises a nucleic acid molecule that has a nucleotide sequence selected from the group consisting of SEQ ID NO .: 1-10 . As used in the present invention, a commodity product refers to any composition or product that is comprised of material derived from a MON 87427 plant, a seed, a plant cell or a plant part. Basic products can be viable or non-viable. Unviable basic products include, but are not limited to, unviable seeds and grains; seeds, seed parts and processed plant parts; dehydrated plant tissue, frozen plant tissue and processed plant tissue; seeds and parts of plants processed for animal feed for terrestrial consumption
Petition 870180065559, of 07/30/2018, p. 31/98
27/84 and / or aquatic animals, oil, coarse flour, fine flour, flakes, bran, fiber, milk, cheese, paper, cream, wine and any other food for human consumption; and biomass and combustible products. Viable commodities include, but are not limited to, seeds and plant cells. The MON 87427 transgenic corn event can thus be used to manufacture any commodity product typically purchased from corn. A commodity product that is derived from MON 87427 may contain a detectable amount of specific and unique DNA that corresponds to MON 87427 and, specifically, may contain a detectable amount of a nucleic acid molecule that has at least one of the sequences provided as SEQ ID NO .: 1-10. The detection of one or more of these sequences in a sample of a commodity product derived from, consisting of, consisting of or comprising a corn plant, a corn seed, a corn plant cell or a plant part maize is conclusive and determinative of the presence of biological material derived from the MON 87427 maize event in such commodity product, and the detection of such nucleic acid molecule can be used to determine the content and / or source of the commodity product . Any standard detection method for nucleic acid molecules can be used, including the detection methods described in the present invention.
[0077] The plants, progeny, seeds, plant cells, plant parts and basic products of the invention are therefore useful to, among other things, grow the plants for the purpose of producing the seeds and / or parts of MON 87427 plant for agricultural purposes, produce MON 87427 progeny for plant production and research purposes, use with microbiological techniques for industrial applications and for research and sale to consumers. [0078] The invention provides methods for controlling weeds when using the herbicide glyphosate and MON 87427. A method for controlling
Petition 870180065559, of 07/30/2018, p. 32/98
28/84 weeds in a field are provided, and consists of planting MON 87427 varietal or hybrid plants in a field and applying an effective dose of glyphosate herbicide in the field in order to control weeds in the field without damaging MON 87427 plants. Such application of the glyphosate herbicide can be pre-emergence, that is, any time after the MON 87427 seed is planted and before MON 87427 plants appear or post-emergence, that is , any time after MON 87427 plants emerged. A dose of glyphosate herbicide effective for use in the field to control weeds should consist of a range of about 0.112 kg (0.1 pound per acre) to as much as about 4.48 kg glyphosate per hectare (4 pounds) per acre) during a growing season. The multiple applications of glyphosate can be used during a growing season, for example, two applications (such as a pre-planting application and a post-emergence application or a pre-emergence application and a post-emergence application) or three applications (such as a pre-planting application, a pre-emergence application and a post-emergence application).
[0079] Methods for producing a MON 87427 transgenic corn tolerant herbicide event plant are provided. The progeny produced by these methods can be varietal or hybrid plants; it can grow from the seeds produced by a MON 87427 plant and / or from the seeds produced by a plant fertilized with pollen from a MON 87427 plant; and can be homozygous or heterozygous for the transgene. The progeny can be subsequently self-pollinated or cross-pollinated.
[0080] A corn plant that tolerates the application of the herbicide glyphosate can be produced by sexual crossbreeding of a MON 87427 plant that comprises a nucleic acid molecule that comprises at least one of the sequences provided as SEQ ID NO .:
Petition 870180065559, of 07/30/2018, p. 33/98
29/84
1-10 with another corn plant to thereby produce the seed, which is then collected and grown on progeny plants. This progeny can then be treated with the glyphosate herbicide and the progeny that is tolerant to the glyphosate herbicide can be selected. Alternatively, these progeny plants can be analyzed using diagnostic methods to select for progeny plants that contain MON 87427 DNA.
[0081] When practicing the methods of the invention, the stage of sexual crossing of a plant with another plant, that is, cross-pollination, can be performed or facilitated by human intervention, for example: by human hands when collecting pollen from a plant and whose pollen comes into contact with the style or stigma of a second plant and then by optionally preventing further fertilization of the fertilized plant; by hands and / or human actions when removing (for example, stripping), destroying (for example, using chemical agents) or covering the stamen or anthers of a plant, so that natural self-pollination is prevented and cross-pollination must occur for fertilization to occur; the human placement of pollinating insects in a position for directed pollination (for example, when placing hives in orchards or fields or imprisoning plants with pollinating insects); by the human opening or removal of flower parts to allow the placement or contact of external pollen on the style or stigma (for example, in corn that naturally has flowers that harm or prevent cross-pollination, making them naturally self-pollinating mandatory without human intervention); by the selective placement of plants in a specific area (for example, by intentional planting of plants in close proximity to pollination); and / or by applying chemicals to precipitate flowering or to promote receptivity (from stigma to pollen).
Petition 870180065559, of 07/30/2018, p. 34/98
30/84 [0082] When practicing the methods of the invention, the sexual fertilization stage of a corn plant by self-pollination, that is, by individualization, can be performed or facilitated by human intervention, for example: by human hands when collecting the pollen from a plant and contact this pollen with the style or stigma of the same plant and then by optionally preventing further fertilization of the fertilized plant; by hands and / or human actions when removing (for example, stripping), destroying (for example, using chemical agents) or covering the stamen or anthers of a plant so that natural self-pollination is prevented and self-pollination manual has to occur for fertilization to occur; the human placement of pollinating insects in a position for directed pollination (for example, by incarcerating a plant alone with pollinating insects); by the human manipulation of the reproductive parts of a plant to allow or intensify self-pollination; by the selective placement of plants (for example, by the intentional planting of other plants besides the proximity of pollination); and / or by applying chemicals to precipitate flowering or to promote receptivity (from stigma to pollen).
[0083] The invention provides plants and methods useful in the production of hybrid maize seeds.
[0084] The corn plant has the male and female flowering parts separated. The tassel is the male structure and the ear bud is the female flowering structure of the plant. The flowering stage in corn involves pollen release and spike. Corn pollen can fertilize the same plant (self-pollination) or a different plant (cross-pollination). If the male structures of the plant are not removed before the pollen is released, then the corn plant will be self-pollinated to some extent. For the production of hybrid seed, the female structures of a first corn plant are pollinated
Petition 870180065559, of 07/30/2018, p. 35/98
31/84 crossed with pollen from a second corn plant. The production of an efficient hybrid seed thus requires that a plant's own pollen is not driven to self-fertilize the plant. Methods for enhancing the production of the hybrid maize seed provided in the present invention comprise growing in an area of a seed or plant comprising MON 87427 and one or more maize plants. The MON 87427 event plants are then treated with glyphosate prior to pollen formation, thereby rendering the MON 87427 event plants male sterile and incapable of self-fertilization. The MON 87427 event plants are then pollinated by pollen from other corn plant (s) using some of the methods described in the present invention. The other corn plant (s) may or may not be glyphosate tolerant. Corn seed is then harvested from MON 87427 event plants, where seed harvested from treated MON 87427 plants has a higher yield of hybrid corn seed (ie, higher percentage of hybrid seed harvested or purity more hybrid seed) than corn seed harvested from untreated MON 87427 event plants or other corn plant (s) under the same conditions. Corn seed harvested from MON 87427 event plants not treated under the same conditions would have a higher percentage of non-hybrid seed (ie, pure-line seed produced by self-pollination) and thus lower seed yield of hybrid corn.
[0085] The plants and methods of the invention can also be used for maize that produces purposes with methods known in the art including using the methods described in United States Patent No. 7,314,970 of the United States, which is hereby incorporated by reference in the present invention and the United States patent publication no. 20090165166, which is incorporated
Petition 870180065559, of 07/30/2018, p. 36/98
32/84 hereby as a reference in the present invention.
[0086] The plants, progeny and seeds covered by these methods and produced using these methods will be distinct from other maize plants. For example, the MON 87427 plants, progeny and seeds of the invention are transgenic and recombinant and, as such, are created by human intervention and contain a detectable amount of a nucleic acid molecule that has at least one of the sequences provided as SEQ ID NO .: 1-10.
[0087] The methods of the invention are therefore useful for, among other things, controlling weeds in a field by growing plants for the purpose of producing MON 87427 seeds and / or plant parts for agricultural or farming purposes research, select MON 87427 progeny for plant production or research purposes and produce MON 87427 progeny plants and seeds.
[0088] Plants, progeny, seeds, plant cells, plant parts and basic products of the invention can be evaluated for DNA composition, gene expression and / or protein expression. Such an assessment can be made by using standard methods such as PCR, Northern blot, Southern blot, Western blot, immunoprecipitation and ELISA, or by using the detection methods and / or the detection kits provided in the present invention.
[0089] Methods for detecting the presence of MON 87427 specific materials in a sample are provided. It is possible to detect the presence of a nucleic acid molecule of the invention by using the probes and primers of the invention with any method of detecting nucleic acid used in the state of the art, such as polymerase chain reaction (PCR) or hybridization of the DNA. One method provides for contacting a DNA sample with a pair of primers that
Petition 870180065559, of 07/30/2018, p. 37/98
33/84 can produce an amplified fragment of DNA from the MON 87427 event, perform an amplification reaction, and thereby produce an amplified fragment of DNA that comprises at least one of the nucleotide sequences provided as SEQ ID NO .: 1 -10 and then detect the presence or absence of the amplified fragment molecule and, optionally, confirm, within the amplified fragment sequence, a sequence comprising at least one of the sequences provided as SEQ ID NO .: 1-10. The presence of such an amplified fragment is determinative and / or diagnostic for the presence of MON 87427 specific DNA and, therefore, MON 87427 biological material in the sample. Another method provides for contacting a DNA sample with a DNA probe, subjecting the probe and the DNA sample to strict hybridization conditions and then detecting hybridization between the probe and the target DNA sample. The detection of hybridization is diagnostic for the presence of MON 87427 specific DNA in the DNA sample. The amplification of the nucleic acid, the hybridization of the nucleic acid and the sequencing of the DNA can be performed by any of the methods known in the art. An exemplary technique useful in the practice of the present invention is TAQMAN® (PE Applied Biosystems, Foster City, CA).
[0090] The heterologous DNA insertion sequence, splice sequences or MON 87427 flanking sequences (with representative seed samples deposited under the ATCC as PTA-7899) can be checked (and corrected, if necessary) amplify such event sequences by using the primers derived from the sequences provided herein followed by sequencing standard DNA from the amplified fragment or cloned DNA.
[0091] DNA detection kits are provided. Variations in such kits can also be developed using the compositions and methods described in the present invention and well-known methods
Petition 870180065559, of 07/30/2018, p. 38/98
34/84 in the state of the art of DNA detection. DNA detection kits are useful for identifying MON 87427 DNA in a sample and can be applied to methods for producing corn plants that contain MON 87427 DNA. Kits can contain DNA primers or probes which are similar or complementary to SEQ ID NO .: 1-10 or fragments thereof.
[0092] The kits and detection methods of the invention are, therefore, useful for, among other things, identifying MON 87427, selecting plant varieties or hybrids that comprise MON 87427, detecting the presence of DNA derived from transgenic MON 87427 in a sample and monitor the samples for the presence and / or absence of MON 87427 or parts of plants derived from MON 87427.
[0093] The invention provides a Relative Development Range useful for monitoring and / or determining reproductive development in corn. This new Relative Development Range resolves differences in developmental and reproductive maturation across several varieties and pure lines of corn by providing a time range that expresses the tassel's developmental stages related to flowering. The Relative Development Range decreases the differences observed in the development of the tassel and the growth of the tassel through genotypes. The development of the tassel in the various stages of maturation is illustrated in Figure 3.
[0094] The development of maize is often determined by a range of stages based on vegetative events, commonly known as Stage V. These stages are defined according to the top leaf on which the leaf collar is visible. VE corresponds to the emergency, V1 corresponds to the first sheet, V2 corresponds to the second sheet, V3 corresponds to the third sheet, V (n) corresponds to sheet n. VT occurs when the last branch of the tassel is
Petition 870180065559, of 07/30/2018, p. 39/98
35/84 visible, but before the ears appear. When presenting a corn field, each specific V stage is defined only when 50 percent or more of the plants in the field are at or beyond that stage. However, the use of this vegetative range to determine reproductive maturity can be complicated by the fact that vegetative development is not necessarily correlated with reproductive development across all genotypes. In addition, not all pure lines differentiate the same number of leaves, field inspectors are not always consistent in their assessment and the first leaves to differentiate begin to senescence reasonably early in the season, and if the leaves are not correctly marked during the initial stages, it becomes very difficult to subsequently correctly identify Stages V.
[0095] Another common tool for predicting and estimating the growth and development stages of corn is the Growing Grade Units (GDU). A factor in maize growth and development is heat. Heat is typically measured at a single point in time and is expressed as temperature, but it can also be measured over a period of time and expressed as units of heat. These heat units are generally referred to as GDU. The GDU can be defined as the difference between the average daily temperature and a selected base temperature subject to certain limitations. The GDU is calculated using the following equation:
Increasing Grade Unit = {(H + L) / 2} - B [0096] where H is the daily rise (but not higher than 30 ° C (86 ° F)) L is the daily low (but not lower than 10 ° C (50 ° F) and B is the base of 10 ° C (50 ° F). Since corn growth is less when temperatures are higher than 30 ° C (86 ° F) F) or lower than 10 ° C (50 ° F), the limits are adjusted to the daily high and low temperatures used in the formula.
Petition 870180065559, of 07/30/2018, p. 40/98
36/84 daily temperature also prevents the calculation of negative values. Therefore, if the high daily temperature exceeds 30 ° C (86 ° F), the high daily temperature used in the GDU formula must be adjusted to 30 ° C (86 ° F). On the other hand, if the daily low temperature drops below 10 ° C (50 ° F), the daily low temperature used in the GDU formula must be adjusted to 10 ° C (50 ° F). If the daily high temperature does not exceed 10 ° C (50 ° F), then no GDU will be recorded for that day. The maximum GDU that a corn plant can accumulate in one day is 36, the minimum GDU is zero. The maturity assessment of a corn plant is identified by adding the daily GDU values over a specified amount of time. The length of time that most corn seed producers employ is from the point of planting to physiological maturity or the point at which the sufficiency of the grain is virtually complete. In most US states, accumulated GDUs are maintained for most geographic areas and are available from the USDA Crop Reporting Service or State Extension Services. In addition, an instrument for obtaining information about GDUs in a particular position is also described in United States Patent No. 6,967,656, which is hereby incorporated by reference in its entirety. As with Stages V, GDU measurements can vary significantly from the stage of development of the tassel through genotypes, and may not be a reliable predictor of the development of the tassel.
[0097] As used in the present invention, a Relative Development Strip is defined as a strip created by dividing the GDU at a given stage of tassel development by the GDU required to obtain a particular pollen release stage. A regression line is then constructed with this information for each genotype or variety of the pure line. A Relative Development Range can be constructed using the methods described in
Petition 870180065559, of 07/30/2018, p. 41/98
37/84 present invention and is based on the correlation between the GDU requirements necessary to reach a certain stage of development of the corn flower relative to a given stage of development of the tassel. In this way, the Relative Development Range is useful for predicting the development of tassel in maize through various genotypes and pure line varieties, and can be used as an alternative to using Stage V or GDUs in plant production and in agricultural methods.
[0098] As used in the present invention, the flower development stage is defined according to the extent to which a plant population releases pollen, called Stage P. The flower development stage is expressed as Px, in that P stands for pollen and x indicates the percentage of plants within a population that release pollen. The Relative Development Range of the invention is based on a regression derived by dividing the GDUs at a given stage of tassel development by the number of GDUs required to obtain a particular pollen release stage. This is expressed as follows:
Relative Development Range = (GDU for Tn / GDU for Px) [0099] where GDU for Tn is the amount of GDU (Increasing Grade Units) required to obtain a certain stage of tassel development, where n can vary 0 to 7 and where GDU for Px is the amount of GDU required to obtain a particular flower development stage or Stage P where x can vary from 0 to 100 (an example of this is P50 defined as the start of release pollen in the field by 50% of plants).
[00100] The regression can be based on the correlative relationship between any tassel development stage and flower development stage or Stage P GDU requirements. Such a correlative relationship is expressed by dividing the GDU required to obtain a stage of development.
Petition 870180065559, of 07/30/2018, p. 42/98
38/84 development of the tassel specified by the GDU required to obtain a specified flower development stage or a Stage P. In one embodiment of the invention, the flower development stage or Stage P for regression is P50, where 50 % of a population of corn plants release pollen. In another modality, the flower development stage or the P pollen release stage for the regression calculation can be from about 1% to 100%, including
cer about 2 3, 4, 5 , 6, 7, 8 , 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96
97, 98 and 99%. The developmental stage of the tassel for regression can be between T0 and T7, such as T0, T1, t2, T3, T4, T5, T6 and T7. Notwithstanding the tassel's developmental stage and the flower's developmental stage chosen when creating the regression, a Relative Development Range can be derived by mapping the relationship of the GDUs required to obtain a particular pollen release stage relative to the number of GDUs required to obtain a given tassel development stage. This aspect is illustrated in Figure 5. As used in the present invention, the term determination refers to the act of measuring, classifying, evaluating, estimating, monitoring and / or forecasting. For example, determining tassel development, as used in the present invention, includes measuring the current stage of tassel development, monitoring progression of tassel development and / or predicting the occurrence of a future stage of tassel development .
[00101] The invention therefore provides a method for producing a Relative Development Range that comprises measuring the Units of Increasing Degree required for a population of
Petition 870180065559, of 07/30/2018, p. 43/98
39/84 corn plants mature at a specific stage of tassel development; the measurement of the Growing Grade Units required for the said population of maize plants to mature to a specific stage of flower development; and the creation of a regression line by dividing the said Growing Grade Units required for said population of maize plants to mature to said specified stage of tassel development by said Growing Grade Units measures required for said plant population of corn to mature at said specified stage of flower development. The measurement step can be repeated for at least two populations of maize plants. The measurement step can be repeated for multiple stages of tassel development and / or multiple stages of flower development. The specific flower development stage may be the release of pollen to about 50 percent of the corn plant population.
[00102] The invention also provides a method for determining the most favorable range within the Relative Development Range for a treatment regime linked to the development of the tassel, thereby allowing the most favorable timing of a treatment regime in which the stage of development is an important factor. An example of this is the application of a single common chemical agent treatment program for maximum effectiveness by causing the sterilization of the corn tassel through different genotypes of the father in the production of hybrid corn seed, regardless of the genotype or the group of maturity.
[00103] As used in the present invention, the term hybrid seed is the seed produced by the cross-pollination of two plants. Plants that have grown from hybrid seed may have increased agricultural characteristics, such as average yield 870180065559, from 07/30/2018, p. 44/98
40/84
Better, greater uniformity and / or resistance to disease. Hybrid seed is not truly produced, that is, seed produced by self-fertilizing a hybrid plant (the plant that grows from a hybrid seed) does not reliably result in the next generation in an identical hybrid plant. Therefore, a new hybrid seed must be produced from the lines of the parent plant for each planting. Since most crop plants have male and female organs, hybrid seed can only be produced by preventing the self-pollination of the female parent and by allowing or facilitating pollination with the desired pollen. There are a variety of methods to prevent self-pollination from the female parent; one method by which self-pollination is prevented is the mechanical removal of pollen producing the organ before the pollen is released. Commercial production of hybrid maize seed (maize, Zea mays) typically involves planting the desired male and female parent lines, usually in separate rows or blocks in an isolated field, treating the female parent plant to prevent pollen release , the guarantee of pollination of the female only by the designated male father and the hybrid seed culture only from the female father. The hybrid seed may be the result of a single cross (for example, a first generation cross between two pure lines), a single modified cross (for example, a cross between two pure lines, where one or the other may have been slightly modified by the use of the strictly related crossing), a first generation double crossing (for example, a first generation of a cross between two single intersections), a triple crossing (for example, a first generation of a cross between a single crossing and a pure line), an upper cross (for example, the first generation of a cross between a pure line and a
Petition 870180065559, of 07/30/2018, p. 45/98
41/84 open pollinated, or the first generation of a cross between a single cross and an open pollinated variety) or an open pollinated variety (for example, a population of plants selected to a pattern that can show variation , but has the characteristics by which a variety can be differentiated from other varieties).
[00104] In the production of the hybrid seed, the production and / or the release of pollen can be prevented in a female parent plant in order to facilitate pollination of the female only by the designated male father and thereby produce the hybrid seed. Such prevention can be achieved by any method or device known to those skilled in the art, including, but not limited to, manual or hand pulling, mechanical pulling, the use of a genetic pollination control device and / or use of a chemical agent. Any of these can be combined or used individually. The stripping can be done manually or by hand and is typically performed by a person who removes the tassels from a corn plant, usually by removing the tassel. Mechanical or machine shedding typically uses a shedding machine called a cutter that moves through the rows of corn and cuts the upper portion of the plant. An extractor machine then moves through the rows of corn a few days later and pulls the plant's tassel out by grabbing it between two high-speed rollers. Mechanical breakers useful in practicing the methods of the invention include those mounted on high purification machines. The cutter can be a blade or a rotating knife that operates in various planes from horizontal to vertical, adjustable in height, to cut or fragment the top of the corn plant including the tassel. The extractor may have two small wheels or rollers, adjustable in height, that rotate in opposite directions and
Petition 870180065559, of 07/30/2018, p. 46/98
42/84 grasp the tassel and the upper leaves, pulling them upwards in a manner comparable to a stripping operation with the hand. Extractors and cutters can be used separately or together and / or in combination with other stripping methods. The time taken for stripping is generally the most critical and difficult to control period in the production of hybrid maize seed. In the state of the art, chemical agents and / or genetic devices are also used to prevent the formation of pollen or the release of viable pollen.
[00105] The invention provides a method for determining the timing of tassel development when selecting a range in a Relative Development Range, where the selected range indicates maturation at a desired stage of tassel development. The desired stage of development of the tassel goes from T0 to stage T7, for example, stage T5. The tassel development stages of particular interest are the most favorable tassel development stage for breeding breeding, the most favorable tassel development stage for sterilization or tassel stripping and / or the most favorable stage for administering tassels. a treatment for modulating the development of a corn plant. When building and using a Relative Development Strip, the specific flower development stage used to build the Relative Development Strip can be in pollen release for about 50 percent of a population of corn plants. An exemplary range in a Relative Development Range useful with the method of the invention is from about 0.62 to about 0.75 in a Relative Development Range.
[00106] Determinations of tassel development timing can be useful for agricultural methods that involve planning and / or standardization practices that are specific to the
Petition 870180065559, of 07/30/2018, p. 47/98
43/84 plant development. Examples of these include: methods that require the timely application of a chemical agent, such as the application of a herbicide, fungicide, fertilizer and / or a growth regulator across pure lines with contrasting maturities; methods that require monitoring, predicting and / or adjusting tassel development, such as monitoring male pure lines for initial tassel development, which may result in decreased pollen release, and providing appropriate treatment to in order to affect the development of the tassel; methods that require the timely application of a hormone and / or a growth regulator to correct an imbalance and / or to produce a desired agricultural outcome; and / or any methods that require the administration of a treatment for modulating development to a corn plant at said desired tassel development stage. The invention can be used in field planning and / or in research work, such as to foresee the work requirements associated with stripping or plant development; predict the requirements related to the development of the tassel determine how stress affects the development of the tassel; and / or for use in the selection and evaluation of pure and hybrid lines and / or lines when imposing stress on a specific developmental stage determined by predicting the tassel's developmental stage.
[00107] The invention provides useful methods for determining when a treatment for developmental modulation is most favorably effective when using the Relative Development Range. As used in the present invention, the term treatment for the modulation of development refers to the administration of at least one physical treatment and / or chemical agent that affects the development of a plant. The development of a plant includes, but is not limited to, flower development, root development,
Petition 870180065559, of 07/30/2018, p. 48/98
44/84 of the leaf, stem development, tassel development, reproductive development, gamete development, pollen development, seed development and / or the development of any other part. The treatment for modulation can cause the development to be stopped, delayed, impeded, delayed or intensified. A treatment for developmental modulation can be a physical treatment, such as stripping, flaring (using a flame torch to scorch the tops of a male plant as a delayed maturation device) and / or wear, friction, scraping, scratching, cutting, drilling, sonication, highlighting, breaking, removing, crushing, pruning and / or covering any part of the plant. A treatment for modulating development can be a chemical agent such as natural compounds or synthetic compounds. Chemical agents that may be useful as a treatment for developmental modulation include plant growth regulators, plant growth regulator inhibitors, plant hormones, plant hormone inhibitors, plant growth stimulators, plant growth retardants plant, fungicides, insecticides, herbicides, auxins, anti-auxins, cytokinins, defoliating agents, ethylene inhibitors, ethylene releasers, gibberellins, morphactins and gametocides. An exemplary physical treatment for use in the methods of the invention is stripping and / or flaming. An exemplifying chemical agent for use in the methods of the invention is the herbicide glyphosate. The treatment for development modulation can be applied to a corn plant at any stage, for example, when the tassel's development stage corresponds to the range of 0.62 and 0.75 in the Relative Development Range, which includes the stage development of the T5 banner. The ability to identify the most
Petition 870180065559, of 07/30/2018, p. 49/98
45/84 favorably effective for the application of a treatment for the modulation of tassel development when using the provided Relative Development Range is an aspect of the invention. Many treatments for modulating tassel development, including chemical agents, which can prevent pollen development or prevent pollen release, are known in the art, and are useful in practicing the methods of the invention.
[00108] The invention can be used to produce a hybrid seed using the methods of the invention. The invention provides methods by which a first corn parent plant is crossed with a second corn parent plant, in which the pollen production of the first corn parent plant is inhibited by the application of a treatment for the modulation of development. The methods of the invention can be used to determine a stage and / or moment of development for the application of the treatment to modulate the development to be more favorably effective. The invention can in particular be employed in the methods provided in United States Patent No. 6,762,344 and US Patent Application Publication No. 2009/0165166. In one embodiment, the invention is a hybrid seed produced by employing the methods of the invention, including plants and plant parts that grew from the hybrid seed and the basic products produced therefrom.
[00109] The invention provides a method for employing MON 87427 transgenic corn event plants for the production of a hybrid seed, in which glyphosate is used as a treatment for modulating tassel development in MON 87427 plants to prevent pollen formation. This is based on the ability to prevent pollen release in female parental lines comprising MON 87427 by the timely application of glyphosate, thereby preventing self-pollination from occurring. If glyphosate is applied too
Petition 870180065559, of 07/30/2018, p. 50/98
46/84 early in relation to the development of the tassel, the male reproductive bodies cannot be sufficiently developed for the treatment to be entirely effective. If applied too late in relation to the development of the tassel, the extrusion of the anther may already be in progress, and the treatment with glyphosate may not prevent the development of the pollen. Thus, the timing of the application of glyphosate in relation to the development of the tassel is important to ensure maximum effectiveness and, therefore, the maximum purity of the hybrid seeds produced. In one embodiment, the most favorable glyphosate application timing for this method can be identified by determining the timing of the tassel development of MON 87427 plants by using a Relative Development Range and by selecting a range in the Relative Development Range that indicates the maturation to a desired stage of development of the tassel. This determination of tassel development timing can then be used to identify timing for glyphosate administration as a treatment for modulating development to a MON 87427 plant, thereby preventing self-fertilization and intensifying hybrid seed production. The methods of the invention reveal that the development of the tassel in the range of 0.62 and 0.75 in the Relative Development Range or T5 is the most favorable range for the application of glyphosate to MON 87427 plants to prevent pollen formation. Therefore, in the Roundup® hybridization system, for any given female parent line of any given maturity group, the most favorable time will be provided by multiplying the GDUs required to obtain P50 for that female parent line by any value within this range. When the result of this calculation is equivalent to the GDUs of that growing season, the most favorable glyphosate application time was obtained. Relative Development Bands can be produced using other
Petition 870180065559, of 07/30/2018, p. 51/98
47/84 pollen release level and other T-band level references that will be similarly useful, without deviating from the scope of the invention. [00110] However, another aspect of the invention provides a method that is useful for determining the stage of development of the tassel at which the reproductive breeding is most favorable. Similar to the way in which developmental differences across genotypes preclude reliable prediction of the most favorable modulation treatments based on Stages V or GDUs alone, cross-pollination timing can also benefit from the Relative Development Range. A simple study using the Relative Development Range can reveal that cross-pollination is more favorable within a certain range in that range. Again, by knowing the GDUs required for P50 of a given genotype, it will be possible to find out when this range is reached without relying on unreliable vegetative level references or by performing time-consuming physical assessments of tassel development. Descriptions of the production methods that are generally used for different traits and cultures can be found in one of several reference books (Allard, Principles of Plant Breeding John Wiley & Sons, NY, U. of CA, Davis, CA, 50- 98, 1960; Simmonds, Principles of Crop Improvement Longman, Inc., NY, 369-399, 1979; Sneep and Hendriksen, Plant Breeding Perspectives Wageningen (ed), Center for Agricultural Publishing and Documentation, 1979; Fehr, in: Soybeans: improvement, Production and Uses, 2nd edition, manograph . , 16:. 249, 1987; Fehr, Principles of Variety Development Theory and Technique, (Vol. 1) and Crop Species Soybean (Vol. 2), Iowa State University, Macmillian Pub. Co., NY, 360-376, 1987).
[00111] When practicing the methods of the invention, one or both parental corn plants may comprise one or more traits desired
Petition 870180065559, of 07/30/2018, p. 52/98
48/84 vehicles of agronomic interest. For example, a MON 87427 corn parent plant can be used in the production of a hybrid seed for production with a second corn parent plant, which comprises at least one gene and / or trait of agronomic interest. In this modality, the Relative Development Range can be used in order to monitor and / or precisely determine the reproductive development stage of the MON 87427 corn parent plant to synchronize the treatment of the MON 87427 corn parent plant with glyphosate prior to pollen formation, thereby preventing self-fertilization. The MON 87427 event plants would then be pollinated by the second parent corn plant, and the hybrid corn seed would be harvested from the MON 87427 event plants, with the seed harvested from MON 87427 treated plants having a seed yield of higher hybrid maize (that is, a higher percentage of the harvested hybrid seed or a higher purity of the hybrid seed) than corn seed harvested from untreated plants or from imprecise timing treatment of plants from the MON 87427 event or other corn plants under the same conditions.
[00112] The traits and genes of agronomic interest are well known in the prior art and include, but are not limited to, for example, those for herbicide resistance, male sterility, increased yield, insect control, disease resistance by fungi, resistance to viruses, resistance to nematodes, resistance to bacterial diseases, plant growth and development, starch production, modified and / or high oil production, modified fatty acid content, high protein production, fruit ripening, intensified animal and / or human nutrition, biopolymers, environmental stress, pharmaceutical peptides and secretory peptides
Petition 870180065559, of 07/30/2018, p. 53/98
49/84 levels, increased processing traits, increased digestibility, low raffinose content, industrial enzyme production, increased flavor, nitrogen fixation, hybrid seed production, fiber production and / or biofuel production. Examples of plants that have one or more desirable traits are those registered with the United States Department of Agriculture Animal and Plant Health Inspection Service (APHIS) for herbicide tolerance (for example, MON 88017, NK603, DAS- 68416-4, HCEM485, DP098140-6, DP-356043-5, MIR604, 59122, TC-6275, Line 1507, MON 802, T14 and / or T25), insect control (for example, MON corn events 863, MON 809, MON 810, MON 89034, MON 88017, MON 802, MIR-162, TC-6275, DBT418, B16, TC-1507, DAS-59122-7, MIR604 and / or MON 80100) and / or others desirable traits (for example, LY038, MON 87460 and / or 3272 maize events) (a complete list and description of such traits is available on the United States government website http://www.aphis.usda.gov/brs /not_reg.html).
[00113] When practicing the methods of the invention, a pure line, variety or hybrid or any other genotype can be used. For example, a pure elite line is a maize plant line that results from superior agronomic performance selection and production. Genotypes can be transformed and / or used in production methods because they comprise a gene of agronomic interest such as glyphosate tolerance, and events can be selected for their suitability as a female or male parent in a hybrid seed production system .
[00114] Elite maize genotypes for use in the practice of the invention include, but are not limited to, CI9805 (U.S. Patent Publication No. 20030093826); LH321 (United States Patent Publication No. 20030106086); HOI002 (Publication of PaPetição 870180065559, of 07/30/2018, page 54/98
50/84 try North American No. 20030154524); HOI001 (United States Patent Publication No. 20030172416); 5750 (United States Patent Publication No. 20030177541); G0502 (Patent Publication
North American No. 20030177543); G1102 (Patent Publication
North American No. 20030177544); HX879 (Patent Publication
North American No. 20040068771); 6803 (Patent Publication
North American No. 20040088767); 5020 (Patent Publication
North American No. 20040088768); G3001 (Patent Publication
North American No. 20040098768); LH268 (Patent Publication
North American No. 20040111770); LH311 (Patent Publication
North American No. 20040111771); LH306 (Patent Publication
North American No. 20040111772); LH351 (Patent Publication
North American No. 20040111773); LHE323 (United States Patent Publication No. 20040111774); 402A (Patent Publication
North American No. 20040123352); 366C (Patent Publication
North American No. 20040139491); NP2315 (United States Patent Publication No. 20040143866); PH0GC (United States Patent Publication No. 20040194170); SE8505 (United States Patent Publication No. 20050015834); D201 (United States Patent Publication No. 20050028236); BE1146BMR (United States Patent Publication No. 20050076402); PHCAM (United States Patent Publication No. 20050114944); PHCK5 (United States Patent Publication No. 20050114945); PHC77 (United States Patent Publication No. 20050114951); PHCND (United States Patent Publication No. 20050114952); PHCMV (United States Patent Publication No. 20050114953); PHB00 (United States Patent Publication No. 20050114955); PHCER (United States Patent Publication No. 20050114956); PHCJP (United States Patent Publication No. 20050120437); PHADA (Publication of Pa
Petition 870180065559, of 07/30/2018, p. 55/98
51/84 try North American No. 20050120439); PHB8V (United States Patent Publication No. 20050120443); 6XN442 (United States Patent Publication No. 20050125864); 4XP811 (United States Patent Publication No. 20050125865); PHCCW (United States Patent Publication No. 20050125866); MN7224 (United States Patent Publication No. 20050132433); BE9514 (United States Patent Publication No. 20050132449); PHCA5 (United States Patent Publication No. 20050138697); PHCPR (United States Patent Publication No. 20050144687); PHAR1 (United States Patent Publication No. 20050144688); PHACV (United States Patent Publication No. 20050144689); PHEHG (United States Patent Publication No. 20050144690); NP2391 (United States Patent Publication No. 20050160487); PH8WD (United States Patent Publication No. 20050172367); D501 (United States Patent Publication No. 20050177894); D601 (United States Patent Publication No. 20050177896); D603 (United States Patent Publication No. 20050177904); PHCEG (United States Patent Publication No. 20050223443); W16090 (United States Patent Publication No. 20050273876); M10138 (United States Patent Publication No. 20050273877); N61060 (United States Patent Publication No. 20050273878); NP2460 (United States Patent Publication No. 20060048243); BS112 (United States Patent Publication No. 20060070146); PHDWA (United States Patent Publication No. 20060107393); PH8JV (United States Patent Publication No. 20060107394); PHEWW (United States Patent Publication No. 20060107398); PHEDR (United States Patent Publication No. 20060107399); PHE67 (United States Patent Publication No. 20060107400); PHE72 (United States Patent Publication No. 20060107408); PHF1J (United States Patent Publication No. 20060107410); PHE35 (Patent Publication
Petition 870180065559, of 07/30/2018, p. 56/98
52/84
North American No. 20060107412); PHEHR (United States Patent Publication No. 20060107415); PHDPP (United States Patent Publication No. 20060107416); PHEHC (United States Patent Publication No. 20060107418); PHANF (United States Patent Publication No. 20060107419); PHC78 (United States Patent Publication No. 20060107420); PH8T0 (United States Patent Publication No. 20060107421); PHDRW (United States Patent Publication No. 20060107422); PHEGV (United States Patent Publication No. 20060107423); PHEBA (United States Patent Publication No. 20060107426); PHENE (United States Patent Publication No. 20060112463); PHEJW (United States Patent Publication No. 20060112464); PHAPT (United States Patent Publication No. 20060112465); PHCND (United States Patent Publication No. 20060130188); PHCEG (United States Patent Publication No. 20060130189); PHADA (United States Patent Publication No. 20060130190); PHEED (United States Patent Publication No. 20060143744); PHHB (United States Patent No. 5,633,427); LH262 (United States Patent No. 5,633,428); LH227 (United States Patent No. 5,633,429); LH226 (United States Patent No. 5,639,941); LH235 (United States Patent No. 5,639,942); LH234 (United States Patent No. 5,639,943); PHDP0 (United States Patent No. 5,639,946); PH06N (United States Patent No. 5,675,066); LH177 (United States Patent No. 5,684,227); PH24E (United States Patent No. 5,689,034); PHP38 (United States Patent No. 5,708,189); ASG06 (United States Patent No. 5,714,671); CG00685 (United States Patent No. 5,723,721); PHND1 (United States Patent No. 5,723,722); PH44A (United States Patent No. 5,723,723); ZS01591 (United States Patent No. 5,723,724); ZS01101 (United States Patent No. 5,723,725); ZS01452 (United States Patent No. 5,723,726); ZS01429 (United States Patent
Petition 870180065559, of 07/30/2018, p. 57/98
53/84
No. 5,723,727); ZS01819 (United States Patent No. 5,723,728); ZS01250 (United States Patent No. 5,723,729); ZS01595 (United States Patent No. 5,723,730); CG3ND97 (United States Patent No. 5,728,923); NP938 (934) (United States Patent No. 5,728,924); PHNG2 (United States Patent No. 5,731,491); CG5NA58 (United States Patent No. 5,731,502); NP948 (United States Patent No. 5,731,503); LH236 (United States Patent No. 5,731,504); CG00766 (United States Patent No. 5,731,506); PHOAA (United States Patent No. 5,750,829); PH15A (United States Patent No. 5,750,830); PH25A (United States Patent No. 5,750,831); PH44G (United States Patent No. 5,750,832); PH0CD (United States Patent No. 6,084,160); ASG25 (United States Patent No. 6,084,161); 86ISI15 (United States Patent No. 6,084,162); BE4547 (United States Patent No. 6,084,163); PH21T (United States Patent No. 6,091,007); 01DHD16 (United States Patent No. 6,096,952); PH224 (United States Patent No. 6,096,953); ASG26 (United States Patent No. 6,103,958); ASG28 (United States Patent No. 6,103,959); PH0V0 (United States Patent No. 6,107,550); 90LCL6 (United States Patent No. 6,111,171); 22DHD11 (United States Patent No. 6,111,172); ASG17 (United States Patent No. 6,114,606);
AR5253bm3 (United States Patent No. 6,114,609); ASG27 (United States Patent No. 6,114,610); WDHQ2 (United States Patent No. 6,114,611); PH3GR (United States Patent No. 6,114,613); PH1NF (United States Patent No. 6,118,051); PH0JG (United States Patent No. 6,118,053); PH189 (United States Patent No. 6,118,054); PH12J (United States Patent No. 6,118,055); PH1EM (United States Patent No. 6,118,056); 90DJD28 (United States Patent No. 6,121,519); PH12C (United States Patent No. 6,121,520); PH55C (United States Patent No. 6,121,522); PH3EV (United States Patent No. 6,121,523); ZS4199 (United States Patent No.
Petition 870180065559, of 07/30/2018, p. 58/98
54/84
6,121,525); PH2V7 (United States Patent No. 6,124,529); PH4TF (United States Patent No. 6,124,530); PH3KP (United States Patent No. 6,124,531); PH2MW (United States Patent No. 6,124,532); PH2N0 (United States Patent No. 6,124,533); PH1K2 (United States Patent No. 6,124,534); PH226 (United States Patent No. 6,124,535); PH2VJ (United States Patent No. 6,127,609); PH1M8 (United States Patent No. 6,127,610); WQCD10 (United States Patent No. 6,130,369); PH1B8 (United States Patent No. 6,130,370); 17DHD5 (United States Patent No. 6,133,512); PH0WD (United States Patent No. 6,133,513); PH3GK (United States Patent No. 6,133,514); PH2VK (United States Patent No. 6,137,036); PH1MD (United States Patent No. 6,137,037); SM4603 (United States Patent No. 6,137,038); PH04G (United States Patent No. 6,140,562); NP2151 (United States Patent No. 6,140,563); PH5DR (United States Patent No. 6,727,413); LH254 (United States Patent No. 6,730,833); PH5WB (United States Patent No. 6,730,834); PH7CH (United States Patent No. 6,730,835); PH54M (United States Patent No. 6,730,836); PH726 (United States Patent No. 6,730,837); PH48V (United States Patent No. 6,734,348); PH3PV (United States Patent No. 6,737,566); PH77V (United States Patent No. 6,740,795); PH7JB (United States Patent No. 6,740,796); NP2316 (United States Patent No. 6,740,797); PH70R (United States Patent No. 6,740,798); RAA1 (United States Patent No. 6,747,194); VMM1 (United States Patent No. 6,747,195); PH3RC (United States Patent No. 6,747,196); MNI1 (United States Patent No. 6,753,465); 5750 (United States Patent No. 6,756,527); PH6KW (United States Patent No. 6,756,528); PH951 (United States Patent No. 6,756,530); PH6ME (United States Patent No. 6,759,578); NP2171 (United States Patent No. 6,759,579); PH87H
Petition 870180065559, of 07/30/2018, p. 59/98
55/84 (United States Patent No. 6,759,580); PH26N (United States Patent No. 6,765,132); RII1 (United States Patent No. 6,765,133); PH9AH (United States Patent No. 6,770,802); PH51H (United States Patent No. 6,774,289); PH94T (United States Patent No. 6,774,290); PH7AB (United States Patent No. 6,777,599); PH5FW (United States Patent No. 6,781,042); PH75K (United States Patent No. 6,781,043); KW7606 (United States Patent No.
6,784,348); PH8CW (United States Patent No. 6,784,349); PH8PG (United States Patent No. 6,784,350); RBO1 (United States Patent No. 6,797,869); 9SM990 (United States Patent No. 6,803,509); PH5TG (United States Patent No. 6,806,408); I501150 (United States Patent No. 6,806,409); I390186 (United States Patent No. 6,806,410); PH6JM (United States Patent No. 6,809,240); KW4636 (United States Patent No. 6,809,243); I363128 (United States Patent No. 6,809,244); LH246 (United States Patent No. 6,812,386); 2JK221 (United States Patent No. 6,812,387); PHN46 (United States Patent No. 5,567,861); ZS0223 (United States Patent No. 5,569,813); phajo (United States Patent No. 5,569,816); PHJJ3 (United States Patent No. 5,569,817); phap8 (United States Patent No. 5,569,818); PHPP8 (United States Patent No. 5,569,819); ZS1284 (United States Patent No. 5,569,820); PHT11 (United States Patent No. 5,569,821); phte4 (United States Patent No. 5,569,822); ZS0114 (United States Patent No. 5,569,826); 7054 (United States Patent No. 5,576,473); ZS0560 (United States Patent No. 5,585,533); ZS0853 (United States Patent No.
5,585,534); ZS1791 (United States Patent No. 5,585,539); ZS1513 (United States Patent No. 5,585,541); ZS1679 (United States Patent No. 5,589,606); ZS1022 (United States Patent No.
5,602,314); ZS1202 (United States Patent No. 5,602,315); ZS1783
Petition 870180065559, of 07/30/2018, p. 60/98
56/84 (United States Patent No. 5,602,316); PHDG1 (United States Patent No. 5,602,318); PHKV1 (United States Patent No. 5,608,138); PHO5F (United States Patent No. 5,608,139); PH38B (United States Patent No. 5,608,140); PH42B (United States Patent No. 5,618,987); PHDD6 (United States Patent No. 5,625,129); ZS0541 (United States Patent No. 5,625,131); PH08B (United States Patent No. 5,625,132); PHOC7 (United States Patent No.
5,625,133); LH233 (United States Patent No. 5,625,135); ASG05 (United States Patent No. 5,723,731); LH281 (United States Patent No. 5,723,739); PHBF0 (United States Patent No. 5,728,919); CG5NA01 (United States Patent No. 5,728,922); AR5651bm3 (United States Patent No. 5,977,458); LH266 (United States Patent No. 5,977,459); LH303 (United States Patent No. 5,977,460); LH301 (United States Patent No. 5,981,855); 4SQ601 (United States Patent No. 5,986,182); PH1TB (United States Patent No. 5,986,184); PH24D (United States Patent No. 5,986,185); LH229 (United States Patent No. 5,986,186); LH277 (United States Patent No. 5,986,187); PHÇN (United States Patent No. 5,990,393); LH261 (United States Patent No. 5,990,394); W1498A (United States Patent No. 5,990,395); WQDS2 (United States Patent No.
5,994,631); NL085B (United States Patent No. 5,998,710); PH09E (United States Patent No. 5,998,711); LH284 (United States Patent No. 6,015,944); PH1B5 (United States Patent No. 6,020,543); PH1CA (United States Patent No. 6,025,547); 7OLDL5 (United States Patent No. 6,031,160); GM9215 (United States Patent No. 6,031,161); 90LDI1 (United States Patent No. 6,031,162); 90LDC2 (United States Patent No. 6,034,304); 90QDD1 (North American Patent No. 6,034,305); R398D (United States Patent No. 6,034,306); RDBQ2 (United States Patent No. 6,037,531); HX621
Petition 870180065559, of 07/30/2018, p. 61/98
57/84 (United States Patent No. 6,040,506); HX622 (United States Patent No. 6,040,507); 01HG12 (United States Patent No. 6,040,508); HX740 (United States Patent No. 6,043,416); 79314N1 (United States Patent No. 6,043,417); 17INI20 (United States Patent No. 6,043,418); 17DHD7 (United States Patent No. 6,046,387); 8INI8 (United States Patent No. 6,046,388); 83InI14 (United States Patent No. 6,046,389); 01INL1 (United States Patent No. 6,046,390); LH286 (United States Patent No. 6,049,030); ASG29 (United States Patent No. 6,054,640); ASG07 (United States Patent No. 6,060,649); QH111 (United States Patent No. 6,069,303); 09DSQ1 (United States Patent No. 6,072,108); JCRNR113 (US Patent No. 6,072,109); NP2029 (United States Patent No. 6,072,110); ASG09 (United States Patent No. 6,077,996); PHOWE (United States Patent No. 6,077,997); 86AQV2 (United States Patent No. 6,077,999); PH1GG (United States Patent No. 6,080,919); RPK7346 (United States Patent No. 6,506,965); NP2044BT (United States Patent No. 6,573,438); PH8W4 (United States Patent No. 6,600,095); M42618 (United States Patent No. 6,617,500); MV7100 (United States Patent No. 6,624,345); 3JP286 (United States Patent No. 6,627,800); BE4207 (United States Patent No. 6,632,986); CI9805 (United States Patent No. 6,632,987); JCR503 (United States Patent No. 6,635,808); NR401 (United States Patent No. 6,635,809); 4VP500 (United States Patent No. 6,635,810); 7SH385 (United States Patent No. 6,642,440); KW4773 (United States Patent No. 6,642,441); NP2073 (United States Patent No. 6,646,187); PSA104 (United States Patent No.
6,646,188); 5XH755 (United States Patent No. 6,653,536); 1445008-1 (United States Patent No. 6,653,537); NP2015 (United States Patent No. 6,657,109); 7SH383 (United States Patent No. 6,660,916); LH310 (United States Patent No. 6,664,451); I880S
Petition 870180065559, of 07/30/2018, p. 62/98
58/84 (United States Patent No. 6,670,531); Rr728-18 (North American Patent No. 6,677,509); LH320 (United States Patent No. 6,683,234); 11084BM (United States Patent No. 6,686,519); W60028 (United States Patent No. 6,686,520); PH1GD (United States Patent No. 6,693,231); LH295 (United States Patent No.
6,693,232); PH1BC (United States Patent No. 6,700,041); PH4V6 (United States Patent No. 6,706,954); NP2276 (United States Patent No. 6,706,955); NP2222 (United States Patent No.
6,710,233); Ph0R8 (United States Patent No. 6,717,036); PH581 (United States Patent No. 6,717,037); PH6WR (United States Patent No. 6,717,038); PH5HK (United States Patent No. 6,717,039); PH5W4 (United States Patent No. 6,717,040); PH0KT (United States Patent No. 6,720,486); PH4GP (United States Patent No. 6,720,487); PHJ8R (United States Patent No. 6,723,900); NP2052 (United States Patent No. 6,723,901); PH7CP (United States Patent No. 6,723,902); PH6WG (United States Patent No. 6,723,903); PH54H (United States Patent No. 6,727,412); 4P33339 (United States Patent No. 5,489,744); PHKM5 (United States Patent No. 5,491,286); LH225 (United States Patent No. 5,491,293); LH185 (United States Patent No. 5,491,294); LH176 (US Patent No. 5,491,296); PHW06 (United States Patent No. 5,495,065); LH252 (United States Patent No. 5,495,067); LH231 (United States Patent No. 5,495,068); PHTE4 (United States Patent No. 5,495,069); PHP38 (United States Patent No. 5,506,367); PHN82 (United States Patent No. 5,506,368); PHTD5 (United States Patent No. 5,527,986); 899 (United States Patent No. 5,530,181); PHAP1 (United States Patent No. 5,530,184); PHKW3 (United States Patent No. 5,534,661); CG00653 (United States Patent No. 5,536,900); PHRD6 (United States Patent No. 5,541,352); PHK46 (United States Patent No. 5,543,575); PHBG4
Petition 870180065559, of 07/30/2018, p. 63/98
59/84 (United States Patent No. 5,545,809); LH189 (United States Patent No. 5,545,811); PHNJ2 (United States Patent No. 5,545,812); PHRF5 (United States Patent No. 5,545,813); PHFR8 (United States Patent No. 5,545,814); PHN18 (United States Patent No. 5,557,034); PHTP9 (United States Patent No. 5,557,038); PH54B (United States Patent No. 5,563,320); PHGF5 (United States Patent No. 5,563,321); PHAG6 (United States Patent No.
5,563,322); PHAP9 (United States Patent No. 5,563,323); PHBE2 (United States Patent No. 5,563,325); ZS0510 (United States Patent No. 5,563,327); PHAAO (United States Patent No.
5,602,317); LH273 (United States Patent No. 5,880,348); 7571 (United States Patent No. 5,880,349); LH237 (United States Patent No. 5,880,350); PH0B4 (United States Patent No. 5,889,188); FEBS (United States Patent No. 5,902,922); 8F286 (United States Patent No. 5,905,191); 3AZA1 (United States Patent No. 5,910,625); 91dfa-5 (United States Patent No. 5,910,635); ASG20 (United States Patent No. 5,910,636); ZS03940 (United States Patent No. 5,912,420); 91ISI6 (United States Patent No. 5,912,421); MF1113B (United States Patent No. 5,914,452); PH03D (United States Patent No. 5,917,125); PHDN7 (United States Patent No. 5,917,134); 01DIB2 (United States Patent No. 5,920,003); 82DHB1 (United States Patent No. 5,922,935); 8M222 (United States Patent No. 5,922,936); PHMJ2 (United States Patent No. 5,929,313); SBB1 (United States Patent No. 5,932,787); 86ISI3 (US Patent No. 5,932,788); ZS01231 (United States Patent No. 5,936,144); 87DIA4 (United States Patent No. 5,936,145); 79310J2 (United States Patent No. 5,936,146); PH1GC (United States Patent No. 5,936,148); 01DHD10 (United States Patent No. 5,939,606); PH2CB (United States Patent No. 5,939,607); PH080
Petition 870180065559, of 07/30/2018, p. 64/98
60/84 (United States Patent No. 5,939,608); PH14T (United States Patent No. 5,942,670); PH185 (United States Patent No. 5,942,671); PH19V (United States Patent No. 5,948,957); ZS09247 (United States Patent No. 5,952,551); Craugsh2w-89 (United States Patent No. 5,952,552); 91DHA1 (United States Patent No. 5,962,770); LH300 (United States Patent No. 5,965,798); 91ISI4 (North American Patent No. 5,965,799); 7910Á1 (United States Patent No. 5,969,212); ASG22 (United States Patent No. 5,969,220); 82IUH1 (United States Patent No. 5,969,221); (United States Patent No. 5,969,222); LH302 (United States Patent No. 5,973,238); LH265 (United States Patent No. 5,973,239); PHFW4 (United States Patent No. 5,977,451); 01IBH10 (United States Patent No. 5,977,452); 91CSI-1 (United States Patent No. 5,977,453); WKBC5 (United States Patent No. 5,977,455); PH1M7 (United States Patent No. 5,977,456); R327H (United States Patent No. 6,399,860); FR2108 (United States Patent No. 6,407,320); FR3383 (United States Patent No. 6,410,830); IT302 (United States Patent No. 6,414,227); FR3303 (United States Patent No. 6,414,228); 9034 (United States Patent No. 6,420,634); G1500 (United States Patent No. 6,420,635); FR3311 (United States Patent No. 6,420,636); I389972 (United States Patent No. 6,420,637); PH77C (United States Patent No. 6,423,888); IT201 (United States Patent No. 6,426,451); G3000 (United States Patent No. 6,426,453); 94INK1B (United States Patent No. 6,429,363); PH3HH (United States Patent No. 6,433,259); 6TR512 (United States Patent No.
6,433,260); 89AHD12 (United States Patent No. 6,433,261); I889291 (United States Patent No. 6,433,262); 2070BT (United States Patent No. 6,437,223); 3323 (United States Patent No. 6,437,224); G1900 (United States Patent No. 6,441,279); 16IUL6
Petition 870180065559, of 07/30/2018, p. 65/98
61/84 (United States Patent No. 6,441,280); 7RN401 (United States Patent No. 6,444,881); UBB3 (United States Patent No. 6,444,882); 6077 (United States Patent No. 6,444,883); I014738 (North American Patent No. 6,444,884); TDC1 (United States Patent No. 6,452,074); GF6151 (United States Patent No. 6,452,075); 7180 (United States Patent No. 6,452,076); WQDS7 (United States Patent No. 6,455,764); X532Y (United States Patent No. 6,459,021); I465837 (United States Patent No. 6,459,022); 1784S (United States Patent No. 6,469,232); LH176Bt810 (United States Patent No. 6,469,233); 6RC172 (United States Patent No. 6,469,234); 3327 (United States Patent No. 6,469,235); 7SH382 (U.S. Patent No. 6,476,298); I181664 (United States Patent No. 6,476,299); NP2010 (United States Patent No. 6,483,014); FR3361 (United States Patent No. 6,483,015); 1778S (United States Patent No. 6,486,386); I362697 (United States Patent No. 6,492,581); RPK7250 (United States Patent No. 6,506,964); and 6RT321 (United States Patent No. 6,911,588).
[00115] As used in the present invention, the term which comprises means including, but not limited to.
[00116] The following examples are included to demonstrate examples of certain preferred embodiments of the invention. It should be appreciated by those skilled in the art that the techniques described in the examples that follow represent approaches that the authors of the invention have found to work well in the practice of the invention and, therefore, can be considered to be examples of the preferred modes for their practice. However, those skilled in the art, in the light of the present description, will appreciate that many changes can be made in the specific modalities that are described, yet obtaining an equal or similar result, without deviating from the character and scope of the invention.
Petition 870180065559, of 07/30/2018, p. 66/98
62/84
EXAMPLES
Example 1: Corn transformation and MON 87427 event selection [00117] The MON 87427 corn plant was produced by Agrobacterium-mediated corn transformation. The corn cells were transformed and regenerated into intact corn plants and the individual plants were selected from the plant population that showed integrity of the transgene expression cassette and resistance to glyphosate. From this population, the MON 87427 corn plant event was selected and characterized.
[00118] The glyphosate-tolerant transgenic MON 87427 maize plant was developed through Agrobacterium-mediated transformation of immature corn embryos using the pMON58401 transformation vector. The transgene insert and MON 87427 expression cassette comprise the promoter and leader of the Cauliflower Mosaic Virus (CaMV) 35S which contain a duplicated enhancer region (P-e35S); operationally linked to a DNA leader derived from the first intron of the corn heat shock protein 70 gene (I-HSP70); operationally linked to a DNA molecule encoding an N-terminal chloroplast transit peptide from the shkG gene of Arabidopsis thaliana EPSPS (Ts-CTP2); operationally linked to a DNA molecule derived from the aroA gene of the CP4 strain of Agrobacterium sp. E that encode the EPS4 CP4 protein; operationally linked to a 3 'UTR DNA molecule derived from the nopaline synthase (T-NOS) gene of Agrobacterium tumefaciens.
[00119] Corn cells can be transformed by a variety of methods. For example, the following method can be used to produce a transgenic corn plant that comprises the plant expression cassette of the invention. Liquid cultures of Agrobacterium tumefaciens that contain the plant expression cassette are initiated from the glycerol raw material or from
Petition 870180065559, of 07/30/2018, p. 67/98
63/84 a freshly streaked plate and grown until the next morning at 26 ° C28 ° C with agitation (about 150 revolutions per minute, RPM) at the medium log growth phase in the liquid LB medium, at pH 7.0, containing 50 mg / l (milligrams per liter) of kanamycin and 50 mg / l of streptomycin or 50 mg / l of spectinomycin and 25 mg / l of chloramphenicol with 200 μΜ of acetosyringone (AS). Agrobacterium cells were resuspended in the inoculation medium (CM4C liquid, as described in Table 8 of U.S. Patent No. 6,573,361) and the cell density is adjusted in such a way that the resuspended cells have a density optics of 1 when measured on a spectrophotometer at a wavelength of 660 nm (ie OD660). The newly isolated immature corn embryos are inoculated with Agrobacterium and are co-cultivated for two to three days in the dark at 23 ° C. The embryos are then transferred to a delay medium (N6 1-100-12; as described in Table 1 of U.S. Patent No. 5,424,412) supplemented with 500 mg / l carbenicillin (Sigma-Aldrich, St Louis, MO) and 20 μΜ of AgNO3) and are incubated at 28 ° C for four to five days. All subsequent cultures are maintained at this temperature.
[00120] Embryos are transferred to the first selection medium (N61-0-12, as described in Table 1 of U.S. Patent No. 5,424,412), supplemented with 500 mg / l carbenicillin and 0.5 mM glyphosate. Two weeks later, the surviving tissues are transferred to the second selection medium (N61-0-12) supplemented with 500 mg / l of carbenicillin and 1.0 mM of glyphosate. The surviving callus is subcultured every two weeks by about 3 subcultures in 1.0 mM glyphosate. When glyphosate-tolerant tissues are identified, the tissue is agglomerated for regeneration. For regeneration, callus tissues are transferred to the regeneration medium (MSOD, as described in Table 1 of U.S. Patent No. 5,424,412) supplemented with 0.1 μM abscisic acid (ABA; Sigma-Aldrich , St. Louis,
Petition 870180065559, of 07/30/2018, p. 68/98
64/84
MO) and are incubated for two weeks. The regenerated calluses are transferred to a medium with a high sucrose content and are incubated for two weeks. The seedlings are transferred to the MSOD media (without ABA) in a culture flask and are incubated for two weeks. Rooted plants with normal phenotypic characteristics are selected and transferred to the soil for growth and further evaluation. The R0 plants generated through the above transformation are transferred to the soil for growth and are then individualized to produce the R1 seed. Plants are selected by a combination of analytical techniques, including TaqMan, PCR analysis and herbicide spray.
[00121] The MON 87427 event was selected from 45 individual transgenic events based on analyzes over several years that demonstrate the phenotypic and superior molecular characteristics of the event and their desirable haplotype association (Cr 9, 60 cM). The selection process for the MON 87427 event started with the transformed corn plants representing 45 R0 events. These were sprayed with glyphosate (4.48 kg / hectare (64 ounces / acre) in V7) and then evaluated for vegetative tolerance and post-spray sterility with glyphosate. Of the initial 45 events, 35 R0 events exhibited a vegetative tolerance to glyphosate and became sterile males when sprayed with the tested rate and glyphosate timing. The plans of these 35 R0 events were then advanced for further characterization by molecular analysis. Using Taqman® analysis, PCR and Southern transfer analysis, the 35 events were characterized molecularly. Of the 35 events analyzed, 29 events were selected for further progress and field tests. The 29 R1 events were then analyzed in field trials for field effectiveness and performance. In addition, a character
Petition 870180065559, of 07/30/2018, p. 69/98
65/84 additional molecular raging was done, including genomic characterization and protein expression. The data were analyzed and, from the detailed analysis of the R1 plant and the results of the field experimentation, three main events were selected and advanced to the R2 field tests. The analysis and subsequent testing of these 3 main events led to the selection of the MON 87427 event.
[00122] An additional field selection included treating the MON 87427 event with glyphosate at 2.24 kg / hectare (32 ounces / acre) (Roundup Ultra®, Monsanto Co., St. Louis, MO) at the growth stage vegetative 4 (V4) and vegetative growth stage 10 (V10). The positive and negative counts of the plant were classified after spraying V4. In addition, the treated plants were classified for chlorosis and malformation 10-14 days after treatment (DAT) after spraying V4 and V10. The sterility evaluations of the flowering tassel were also classified for plants sprayed in V4 and V10.
Example 2: Characterization of MON 87427 DNA sequences [00123] The DNA inserted into the MON 87427 plant genome and the corn flanking genomic sequence were characterized by detailed molecular analyzes. These analyzes included: sequencing the transgene insertion DNA and the genomic DNA that flanks the transgene insertion, determining the transgene insertion number (number of integration sites within the corn genome), determining the number of copies (number of transgene DNA copies within a locus), analysis of the integrity of the inserted gene cassette, analysis of the genomic DNA that flanks the insertion and the association of the insertion with the haplotype regions of the corn genome.
[00124] The sequences that flank the DNA insertion of the transgene in MON 87427 were determined using PCR techniques.
Petition 870180065559, of 07/30/2018, p. 70/98
66/84
The plant's genomic DNA was isolated from the transgenic line from tissue that grew under standard greenhouse conditions. The plant tissue was combined with liquid nitrogen and crushed to a fine powder using a mortar and pestle. DNA was extracted using a Nucleon ™ PhytoPure ™ Genomic DNA extraction kit (RPN8511, Amersham, Piscataway, NJ) according to the manufacturer's protocol. After the final precipitation step, the DNA was resuspended in 0.5 ml TE (10 mM Tris-HCl at pH 8.0, 1 mM EDTA). This method can be modified by the element skilled in the art to extract DNA from any corn tissue, including, but not limited to, the seed. An aliquot of the DNA was digested with the selected restriction endonucleases based on the restriction analysis of the transgene DNA. After self-ligation of the restriction fragments, PCR was performed using primers designed from the DNA sequence of the transgene that would amplify the sequences extending away from the 5 'and 3' ends of the transgene DNA. The PCR products were separated by agarose gel electrophoresis and were purified using a QIAGEN gel purification kit (Qiagen, Valencia, CA). Subsequent DNA products were directly sequenced using standard DNA sequencing protocols. The 5 'flanking sequence that extends to the right edge (RB) sequence of the expression cassette transgene DNA is shown as SEQ ID NO .: 7. The 3' flanking sequence that extends to the edge sequence left (LB) of the transgene DNA of the expression cassette is shown as SEQ ID NO .: 8. The sequence entirely integrated with the genomic DNA of corn and containing the DNA of the expression cassette is presented as SEQ ID NO: .: 9.
[00125] The isolated sequences of the DNA molecule were compared to the DNA sequence of the transgene to identify the sequence of
Petition 870180065559, of 07/30/2018, p. 71/98
67/84 flanking and the DNA fragment of the coisolated transgene. Confirmation of the presence of the expression cassette was obtained by PCR with the primers designed based on the flanking data deduced from the sequence and the known sequence of the transgene DNA. The wild-type sequence that corresponds to the same region in which the transgene DNA was integrated into the transformed line was isolated using the primers designed from the flanking sequences in MON 87427. PCR reactions were performed using the amplification system Elongase® (Invitrogen, Carlsbad, CA). The DNA flanking sequences in MON 87427 and the wild-type sequence LH198 were analyzed against databases of multiple nucleotides and proteins. This information was used to examine the relationship of the transgene with the plant's genome and to look for the integrity of the insertion site.
Example 3: Useful methods for identifying MON 87427 DNA in a sample [00126] This example describes methods useful for identifying MON 87427 event DNA in a sample. The flanking sequence (s) of the event, the genomic sequence of wild-type corn and / or the transgene sequence can be used to design the primers and probes for use in such methods. The primer (s) and the internal control probe (s) may or may not be included in an assay.
[00127] Termination TAQMAN® thermal amplification methods to identify the MON 87427 event (specific event assay) and / or the CP4-EPSPS synthetic gene (also known as CP4-Zm) (specific transgene assay) of the event MON 87427 in a sample are described. The flanking sequence (s) of the event, the genomic sequence of the wild type corn and the sequence of the transgene were used to design the primers and probes for the
Petition 870180065559, of 07/30/2018, p. 72/98
68/84 use in these tests (Table 1). The DNA primers used in the event specific assay are primers SQ12763 (SEQ ID NO .: 17) and SQ12886 (SEQ ID NO: 18) with the probe labeled PB4352 6-FAM ^TM (SEQ ID NO .: 19 ). The DNA primers used in the specific transgene assay are primers SQ20052 (SEQ ID NO .: 11) and SQ20053 (SEQ ID NO .: 12) with the probe labeled PB10016 6-FAM ^TM (SEQ ID NO .: 13). 6-FAM ™ is a fluorescent dyeing product from Applied Biosystems (Foster City, CA) attached to the DNA probe. Controls for this analysis should include a positive corn control that contains MON 87427 event DNA, a negative non-transgenic corn control and a negative control that does not contain any template DNA. [00128] In addition, an optional control for the PCR reaction can include Internal Control Primers and an Internal Control Probe, specific to a single copy gene in the corn genome. One skilled in the art will know how to design primers specific to a single copy gene in the corn genome. The DNA primers used in the specific transgene assay as internal controls are primers SQ1241 (SEQ ID NO .: 14) and SQ1242 (SEQ ID NO: 15) with the probe labeled VIC TAMRA PB0084 (SEQ ID NO .: 16). For internal control of the specific transgene assay, primers and probes can be used with optional steps 5-6 below. For the specific test of the event, no internal control is used.
Table 1: Initiators and Probes (TABLE 1)
Probe InitiatorsCP4Zmdescription Name SSEQ IID No. Sequence Primer of Transgene 1 SQ20052 11 GGCAACCGCTCGCAAAT Primer of Transgene 2 SQ20053 112 ATCGCCCGGAATCCTGA
Petition 870180065559, of 07/30/2018, p. 73/98
69/84
Transgene 6-FAM ^TM probe PB10016 113 6FAMTTCCGGCCTTTCGGGAA Internal control SQ1241 114 GCCTGCCGCAGACCAA Internal control SQ1242 115 CAATGCAGAGCTCAGCTTCATC VIC probe ofInternal trolley PB0084 116 VICTCCAGTACGTGCAG-TCCCTCCTCCCTTAMRA Probe InitiatorsMON87427 description NameSequence Event Primer 1 SQ12763 117 CGGAAACGGTCGGGTCA Event Primer 2 SQ12886 118 CTCCATATTGACCATCATACTACT-CATTGC Event 6-FAM ^TM probe PB4352 119 6FAM-AATGTAGAAAATCGGGACAA-TMGBNFQ
[00129] Examples of useful conditions with TAQMAN® termination methods are as follows:
[00130] Step 1: 18 megaohms of water adjusted to a final volume of 10 pl.
[00131] Step 2: 5.0 pl of 2X Universal Master Mix (dNTPs, enzyme, buffer) at a final concentration of 1X.
[00132] Step 3: 0.5 pl of the Mixture of Event Primer 1 (SEQ ID NO .: 17) and Event Primer 2 (SEQ ID NO .: 18) (resuspended in 18 megaohms of water at a concentration of 20 µM for each primer) at a final concentration of 1.0 pM (for example, in a microcentrifuge tube, the following must be added to obtain 500 pl at a final concentration of 20 pM: 100 pl of Primer of Event 1 (SEQ ID NO .: 17) at a concentration of 100 pM; 100 pl of Event Primer 2 (SEQ ID NO .: 18) at a concentration of 100 pl; 300 pl of 18 megaohms of water).
[00133] Step 4: 0.2 pl of the 6-FAM ™ Event MGB Probe (SEQ ID NO .: 19) (resuspended in 18 megaohms of water at a concentration of 10 pM) at a final concentration of 0.2 pM.
Petition 870180065559, of 07/30/2018, p. 74/98
70/84 [00134] Step 5 (Optional): 0.5 μΙ of the mixture of Internal Control Primer 1 and Internal Control Primer 2 (resuspended in 18 megaohms of water at a concentration of 20 μΜ for each primer) at a final concentration of 1.0 μΜ.
[00135] Step 6 (Optional): 0.2 μl of VIC ™ Internal Control Probe at a final concentration of 0.2 μΜ (resuspended in 18 megaohms of water at a concentration of 10 μΜ).
[00136] Step 7: 3.0 μl of the extracted DNA (template) for each sample with each of the following comprising: 1. Samples of the leaf to be analyzed; 2. Negative control (non-transgenic DNA); 3. Negative water control (no mold); 4. MON 87427 DNA from the positive control.
[00137] Step 8: Thermal cycler conditions as follows: One cycle at 50 ° C for 2 minutes; a cycle at 95 ° C for 10 minutes; ten cycles (at 95 ° C for 15 seconds and then at 64 ° C for 1 minute with -1 ° C / cycle); thirty cycles (at 95 ° C for 15 seconds and then at 54 ° C for 1 minute); final cycle at 10 ° C.
[00138] These tests are optimized for use with a thermal cycler from Applied Biosystems GeneAmp® PCR System 9700 (run at full speed) or MJ Research DNA Engine PTC-225. The other methods and devices known to those skilled in the art for the production of amplified fragments that identify the DNA of the MON 87427 event are within the technique.
[00139] SEQ ID NO .: 11 and SEQ ID NO: 12 or SEQ ID NO .: 17 and SEQ ID NO .: 18 are each an example of a pair of molecules of DNA (a pair of primers) consisting of a first DNA molecule and a second DNA molecule different from the first DNA molecule, wherein said first and second DNA molecules each comprise a nucleic acid molecule which has a nucleotide sequence of sufficient length of
Petition 870180065559, of 07/30/2018, p. 75/98
71/84 contiguous nucleotides of SEQ ID NO .: 10 that function as DNA primers when used together in an amplification reaction with the DNA derived from the MON 87427 event to produce a diagnosis of the amplified fragment for the MON 87427 DNA in a sample. These primers can be used in other methods based on the polymerase chain reaction (PCR) to detect the event.
Example 4: Use of the MON 87427 event for the production of a hybrid seed [00140] The following example describes how it is possible to use MON 87427 for the purposes of maize production including the use of the methods described in US Patent Publication N °. 20090165166 and / or in US Patent No. 7,314,970. [00141] In the production of hybrid seed, the corn plants comprising MON 87427 are planted in an area, such as in an open field. Other corn parental plant (s) may or may not be present in the same area. For the control of weeds during seed production and in commercial fields, glyphosate can be applied to corn plants comprising MON 87427 in the vegetative stages, as instructed on the label of the agricultural product Roundup®, at the same rates used in the events of corn NK603 and MON 88017 in Roundup Ready®. For hybrid seed production, two applications of glyphosate beginning immediately before and / or during tassel development stages (approximate vegetative growth stages of corn ranging from V8 to V13) are applied to MON 87427 plants to produce a male phenotype sterile through tissue selective glyphosate tolerance. In a hybrid corn seed production system, MON 87427 plants with glyphosate applied in synchrony with tassel development
Petition 870180065559, of 07/30/2018, p. 76/98
72/84 will be sterile males and thus can be readily pollinated by other pollen-providing plants (males), resulting in a viable hybrid corn seed that carries the gene for a selective tissue glyphosate tolerance. Pollen-providing plants may be present in the same area or not. Pollination can be affected by any devices known in the art, including by placing plants in close proximity or by manual pollination. Only specifically programmed glyphosate applications that begin immediately before and / or during tassel development stages (approximate maize vegetative growth stages ranging from V8 to V13) will produce a sterile male phenotype through selective tissue glyphosate tolerance in MON 87427. Glyphosate is a systemic herbicide that is readily translocated through phloem in plants. Once the glyphosate is in the phloem, it moves to areas of high meristematic activity, following a typical source to lower the level of distribution. The development of pollen in a corn plant takes about four weeks to complete. The growth stages of the tassel begin in the vegetative growth stage of V9 corn, therefore, the glyphosate applications made at this stage and time allow maximum glyphosate translocation to male reproductive tissues. Glyphosate applications made during the early vegetative stages, consistent with the application timing specified on the current Roundup® agricultural product label for weed control purposes, do not affect MON 87427 pollen production because sensitive male reproductive tissues do not are actively developing right now. Modifications can be made to the glyphosate treatment conditions that are known to the elements skilled in the herbicide application technique, and are within the scope of the invention.
Petition 870180065559, of 07/30/2018, p. 77/98
73/84 [00142] MON 87427, when crossed with another glyphosate tolerant corn event such as the NK603 corn event (United States Patent No. 6,825,400) to produce the hybrid seed, shows no loss performance compared to the performance of the conventional NK603 hybrid (see Figure 2). A field of hybrid maize plants was treated with glyphosate in two successive sprays at 2.25 kg ea / hectare (2.25 pounds / acre) each for weed control, and no difference was observed in relation to the lesion or male fertility between the various MON 87427 hybrids and the NK603 hybrid. This illustrates that F1 hybrid plants from MON 87427 crosses are entirely tolerant to glyphosate when used for weed control.
Example 5: Stages of measuring tassel development [00143] The stages of tassel development are illustrated in Figure 3, with an approximate size in millimeters, shown in parentheses. In the figure, Vg is the meristem in the vegetative stage; T0 is the change from vegetative to reproductive; T1 is the visible growing reproductive point (0.9 mm); T2 are the beginnings of the lateral branch visible (1.8 mm); T3 are the beginning of the spikelet visible (4.1 mm); T4 is the elongation of the central axis and the lateral axis (12.9 mm); T5 is the beginning of anther differentiation (41.0 mm); T6 is the beginning of pollen differentiation (175 mm); and T7 is the manifestation of the anther and the release of pollen (285.0 mm). The stage of development of the tassel for a given plant was measured by examining the tassel at various stages of maturation. By using a scalpel and fine forceps under a dissection scope, the tassel meristem was dissected away from the developing leaves. The meristem was then cut at its base with the scalpel and was evaluated according to the stages of development of the tassel (shown in Figure 3) through observation under a microscope.
Example 6: Vegetative stage of development (Stage V) relative
Petition 870180065559, of 07/30/2018, p. 78/98
74/84 to the tassel development stage [00144] This example demonstrates that the tassel's dry weight, tassel length and tassel development stage vary significantly across genotypes when measured against plant vegetative stages and growth vegetative of the plant.
[00145] Ten genotypes were planted: pure lines LH198, LH287, O1DKD2, 19HGZI, 17IDI6 and hybrids DKC 44-46, DKC 47-10, DKC 5240, DKC 58-80, DKC 63-81. The hybrids were selected to be representatives of genetics that would present a different pattern of development. The study was conducted in Farmer City (IL), Kearney (NE) and Williamsburg (IA). The ten genotypes were planted with a cone planter and were diluted to a final level of 38,000 plants per acre. The length of the lot was 20 feet with alleys of 3 feet by four rows to ensure sufficient plants for all treatments and to reduce the effects of the edges. The data were collected to record the observations of the vegetative development of the plant and the development of the tassel related to the stages of development of the tassel.
[00146] Distinct differences in the development of the tassel were observed between the genotypes in the respective identical vegetative stages (Stages V). For example, the differences in tassel size between genotypes were evident in each Stage V. The average length of the tassel in stage V8 was 7 mm for LH198, 40.2 mm for LH287 and 47.8 mm for DKC44-46 ( Figure 4). This range of length of tassel length in stage V8 represents a difference of up to seven times between the genotypes. In stage V10, the average tassel lengths for these three genotypes were 70.1 mm, 148.2 mm and 277.3 mm, respectively (Figure 4). This resulted
Petition 870180065559, of 07/30/2018, p. 79/98
75/84 in a range of almost 4-fold difference between genotypes. The genetic variation in tassel growth relative to Stages V is also obvious when examining the dry weight accumulation of the tassel.
[00147] In an additional study, seventy-two pure lines were used to capture a wide range of maturities. These pure lines were grouped into six groups of maturity to simplify the dissection process (Table 2). The uncharacterized pure lines were chosen to avoid the complexity of conducting tassel dissections in the regulated fields. This experiment reflects data collected from four different field locations: Williamsburg (IA), Waterman (IL), Farmer City (IL) and Constantine (MI). Lots of four rows by 20 feet in length were produced. The final target population was 38,000 plants per acre. Final counts were documented at stage V3. The fifth and tenth leaves of three representative plants per lot were marked for the monitoring of Stages V; all leaves were counted including coleoptiles. Three representative plants from each group were tested at 60, 70 and 80% of the medium growth development units until flowering (defined as when about half of the tassels in that group were releasing pollen, represented as P50) and tassel dissections were performed as previously described.
Table 2 (TABLE 2)
Maturity Groupdade Group 1 Group 2 Group 3 Group 4 Group 5 Group 6 Average GDU forP50% 11200 11280 11330 11370 11420 11460 First said-cation 7720 7768 7798 8822 8852 8876 Second dissection 8840 8896 9931 9959 9994 11022
Petition 870180065559, of 07/30/2018, p. 80/98
76/84
Third said- 9960 11024 11064 11096 11136 11168 cation
[00148] The plants were chosen from the middle rows in order to avoid plants from the edges. At the time of the first sampling, plants at a consistent stage of development were marked to be used for the second and third samplings. The dates of each dissection together with Stage V at sampling times were documented. The developmental stage of the tassel was identified following the Relative Development Range, as described above. The batches continued to be monitored through flowering, and the date of P50 was recorded. The vegetative stage varied through the stages related to the development of the tassel of the pure lines. For example, Stage V at T5 (beginning of anther differentiation) varied by more than 6.5 leaves across the 7 to 14 leaf pure lines. This represented about 64% of the total average of 10.3 sheets to reach this stage.
Example 7: Average GDUs for Tassel and Flower Development Stages [00149] This example demonstrates that the average GDUs required to achieve a given tassel or flower development stage can vary significantly across genotypes and therefore GDUs do not represent a reliable prediction of tassel development. The data were taken from the field lots and from the pure line plants described above. The plantation temperatures were monitored hourly through flowering, using the Onset weather stations, and the data were used to calculate the daily cumulative GDUs following the traditional method (that is, averaging the maximum and minimum daily temperatures ). The data from the tested dissections that indicate the stage of development of the tassel were mapped against the requirements of the GDUs. It is generally expected that the pure lines that differentiate a greater number of leaves
Petition 870180065559, of 07/30/2018, p. 81/98
77/84 have a higher GDU requirement in order to reach a specific stage of tassel development. However, the variation observed in Stages V to T5 discussed above did not explain the entire variation observed in the GDU for T5. This could suggest that the phyllochron, defined as the time between elongation of successive leaves, can vary between pure lines. The results of this study showed that the GDU to reach the T5 stage varied over 400 units of increasing degree or heat across the pure lines; about 40% of the total average.
[00150] A strong correlation between GDU requirements for P50 and a given stage of development of the tassel through the varieties of the pure line was observed. When using data from field lots and pure line plants, the average GDU requirements for P50 were recorded across the pure lines and compared to data on tassel development stages. The GDU requirements for P50 ranged from 1283 to 1645 units, from the shortest to longest pure line; slightly over a difference of 360 GDUs. These differences were found to correlate with differences in the average GDU requirements for stage T5 within the pure lines (Figure 5).
Example 8: Construction of a Relative Development Range [00151] This example demonstrates the construction of a standardized range for monitoring and / or forecasting the development of the tassel. This Relative Development Range has successfully standardized the development stages of the corn tassel across the pure lines.
[00152] Given the strong correlation between the GDU requirements to obtain P50 at a given stage of tassel development through the pure line varieties, as described above, the Relative Development Range was developed. This was calculated by expressing the growth of the tassel of each genotype relative to the thermal time
Petition 870180065559, of 07/30/2018, p. 82/98
78/84 for Pollen Release, as follows:
Relative Development Range = (GDU for Tn / GDU for Px) [00153] The data were used from the field lots and pure line plants described above. The value of GDUs at a given tassel development stage (GDU for Tn) was divided by the number of GDUs known to be required to obtain a particular pollen release stage (GDU for Px) which, in this case, was P50 for a given genotype. This identified differences in the stage of development of the tassel through the genotypes. For example, the GDU requirements to achieve T5 were reasonably consistent in the Relative Development Range across all pure lines and varied only from 69 to 75% of the GDUs required for P50. The variation in the regression lines of the GDU requirements of various genotypes relative to the stage of development of the tassel compared to the more consistent regression lines of those same genotypes that use the standardized T range was used to assess the standardization of the range, despite the maturity group (Figure 7).
Example 9: Prediction of more favorable timing for the development modulation treatment [00154] This example demonstrates the use of the Relative Development Range to determine the most favorable timing for a spraying regime of the chemical agent in order to obtain complete sterility of the corn tassel. In this example, the chemical agent was Roundup® glyphosate herbicide used in combination with MON 87427 maize plants in the Roundup® (RHS) hybridization system. The most favorable sprinkling time was correlated with the actual stage of development of the tassel, and the complete sterility of the corn tassel was achieved with only a single effective dose of Roundup®. [00155] Thirty-two bases of pure line comprising the
Petition 870180065559, of 07/30/2018, p. 83/98
79/84 MON 87427 event were selected for the study and grouped into two maturity groups. The pure lines were planted in rows of twenty feet, with three-foot alleys. The row spacing was 30 inches between plants. The rows were planted in such a way that there were four rows of female test plants followed by two rows of male pollinating plants. Transgenic events were selected for this study that had a tolerance to vegetative glyphosate and female tissue, but not a tolerance to male reproductive tissue (that is, a selective tolerance to tissue glyphosate). Male pollinators were also male tolerants of glyphosate, although female recipient plants were sensitive to males when treated with glyphosate. The spray treatments were blocked and sub-grouped in two, based on the maturity of the pure line. Immediately before each sprinkling, three representative plants from each batch were selected and dissected in the field. The length of the tassel, the stage of development of the tassel, the date and the GDU on the sprinkler were recorded. Roundup PowerMAX ™ spray treatments (SS1) with a water volume of 15 gallons / acre were applied once to the respective maturity group for each treatment using a high-clearance sprinkler. The spray sterility treatments were applied in a range of 50% to 80% of the GDUs required to obtain P50 (with its average calculated within the maturity group of the pure line), as shown in Table 3, where WC = Weed Control; Trt 1 SS1 = 50% of GDUs for P50; Trt 2 SS1 = 57.5% of GDUs for P50; Trt 3 SS1 = 65% of GDUs for P50; Trt 4 SS1 = 72.5% of GDUs for P50; Trt 5 SS1 = 80% of GDUs for P50.
Table 3
Toilet sprinkles = 22 ounces / acre (0.75 # ae / ac), SSI sprinkles = 33 ounces / acre (1.25 # ae / ac)
Petition 870180065559, of 07/30/2018, p. 84/98
80/84
GDU inFahrenheit(FGDU)Vv3 6650 7570 8850 9950 11050 11150 Trt 1 Maturity 1 WwC SsS1 Maturity 2 WwCSsS1 Trt 2 Maturity 1 WwCSsS1Maturity 2 WwC SsS1 Trt 3 Maturity 1 WwC SsS1 Maturity 2 WwC SsS1 Trt 4 Maturity 1 WwC SsS1 Maturity 2 WwC SsS1Trt 5 Maturity 1 WwC SsS1 Maturity 2 WwCSsS1 [00156] Following toc the the spray treatments, evaluations
sterility / fertility of the tassel were conducted by evaluating anther extrusion and pollen release related to the emergence of the ear. These evaluations were carried out when each lot was in specific developmental stages: 10% of the plants at the entrance with ear (S10); 50% of the plants at the entrance with ear (S50); 90% of the plants at the entrance with ear (S90); 3 days after the date S90 (S90 + 3); and 6 days after the date S90 (S90 + 6). The plants were observed for anther extrusion (AE), and sterility was measured using an Anther Extrusion Risk index (AE Risk) which is a weighted average that combines the percentage of plants in the lot showing the extrusion of the anther. anther with the intensity of the phenomena. For example, Partial Light (LP) is a tassel with 10 or less anthers being extruded. Medium Partial (PM) is a tassel with> 11 anthers up to 25% anthers in extrusion. Heavy Partial (HP) is a tassel that has> 25% anthers in extrusion. As shown in Figure 6, the Relative Development Range reveals a more favorable window of effectiveness for the chemical agent to produce a sterility of the corn tassel between 0.62 and 0.75 in which the AE Risk is minimized by
Petition 870180065559, of 07/30/2018, p. 85/98
81/84 of pure lines and maturity groups. This study confirms the effectiveness of the Relative Development Strip as a tool to provide spray recommendations for the implementation of a Roundup® hybridization system across pure lines. This would be of particular use with MON 87427.
Example 10: Hybrid seed production method with increased seed purity [00157] Hybrid seed production methods and the resulting seed purity were measured using twenty-four pilot production blocks at sites in Kearney, Nebraska; Williamsburg, Iowa; Waterman, Illinois; Farmer City, Illinois; and Constantine, Michigan. Four blocks of MON 87427 and two blocks of cytoplasmic tassel sterility (CMS) were planted in each position. The MON 87427 blocks consisted of 01DKD2MON87427-MON89034 female x 80IDM2MON88017 male, and the CMS blocks consisted of 01DKD2NK603B-CMS female x 80IDM2MON88017 male.
[00158] The planting pattern had a female to male ratio of 4: 1 in rows of 30 inches. Each experimental block had panels measuring ten by 30.5 to 45.7 m (100 to 150 feet) in length. The blocks were surrounded by 9.1 m (30 feet) of males (12 rows) on the sides as well as in the anterior and posterior parts. The blocks were at least 61.0 m (200 feet) away from other potential pollen sources and were isolated from each other by 13.7 m (45 feet). The study was planted in a population of 40,000 and 38,000 for irrigated and non-irrigated land, respectively. The female and male ranks were planted at the same time. The male rows were burned in the V3 growth stage to obtain stunted growth and delay pollen release in male plants by alternately burning 6.1 m (20 ft) long sections of rows. Propane flares were assembled
Petition 870180065559, of 07/30/2018, p. 86/98
82/84 behind a tractor and were positioned on the male rows and alternated between flaring and non-flaring about every 6.1 m (20 feet). The insecticide was used in the plantation to minimize variability due to insect pressure. The male ranks were destroyed after pollination. All blocks were sprayed with 0.34 kg (0.75 lb) a.e./acre of Roundup PowerMax ™ around V3 for weed control purposes. In addition, MON 87427 blocks were sprayed with two sprays at 0.34 kg (0.75 lb) a.e./acre of Roundup PowerMax ™ applied to 825 and 975 Growing Grade Units (GDU) from the plantation. The spray volume was kept constant at 15 gallons per acre (GPA).
[00159] The sterility of the tassel was assessed by monitoring the plants every two days from the emergence of the tassel up to six days after the end of the ear (P90 + 6 days). If rupture (pollen release) occurred, individual plants were further categorized as low pollen content (LP; less than 10 exposed anthers), medium pollen content (PM; 11 anthers up to 25% of the tassel surface area with anthers in extrusion) or high pollen content (HP; more than 25% of the surface area of the tassel with anthers in extrusion). An Anther Extrusion Risk (AE Risk) was then calculated as:
% AE Risk = ([(LPx0.25) + (MPx0.5) + (HPx1.0)] / standard count) x 100 [00160] After physiological maturity and with a seed moisture content of about 30-35%, a composite sample of 100 ears per block harvested manually, following a predetermined sampling scheme to represent all panels in the block. The samples were dried and weighed to adjust the final yield. A first set of samples was treated manually and sent for quality analysis (evaluation of cold germination and hot germination using two replicates of 100 seeds. A second set of samples was sent for analysis of genetic purity
Petition 870180065559, of 07/30/2018, p. 87/98
83/84 (single nucleotide polymorphism analysis (SNPs)) and the trace purity analysis (male specific marker ELISA). A third set of samples was used to document the seed size distribution. The pilot production blocks were harvested in a combined manner and the yield was adjusted to 15% moisture in the determination of gallons per acre.
[00161] In general, both the CMS and MON 87427 blocks exceeded the standards of corn tassel sterility and seed purity. The risk of anther extrusion was well below the desired performance standard of 0.5%, even 6 days after 90% of the female population had manifested ears (Figure 8). Almost no rupture has been documented in the MON 87427 blocks, but a slightly higher rate of rupture in the later spike stages has been observed in the CMS blocks. The female and male parental corn plants for CMS and MON 87427 were tested for genetic purity, and the results showed 100% purity. The high levels of sterility of the corn tassel in the parent plants of MON 87427 and CMS produced high levels of genetic purity and trace purity in the hybrid seed produced from these experiments (Figure 9). There was no statistically significant difference for the trace purity between MON 87427 and CMS, but a statistically significant difference (at p <0.05) was measured for the genetic purity between MON 87427 and CMS. The level of genetic purity of the hybrid seed produced when using MON 87427 and the Roundup® hybridization system (RHS) was 98.7%, which was significantly higher than the level of genetic purity of the hybrid seed produced when using CMS (98.0%). This resulted in MON 87427 female parent plants that produce about 0.2% less 'individuals' and 0.5% less 'others' than the parent plants of the CMS system, demonstrating that this use of MON 87427 with
Petition 870180065559, of 07/30/2018, p. 88/98
84/84 the Roundup® hybridization system (RHS) can be made to improve the purity of corn seed in the production of hybrid corn seed.
[00162] A deposit of a representative sample of the MON 87427 seed described above and cited in the claims was made under the Budapest Treaty with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA. 20110. The ATCC Accession Number for this deposit is PTA-7899. The deposit will be kept in the depository for a period of 30 years or 5 years after the last application, or for the effective period of the patent, which is longer, and will be replaced as needed during that period.
[00163] Having illustrated and described the principles of the invention, it should be evident to elements versed in the technique that the invention can be modified in the arrangement and detail without deviating from such principles. All modifications that are within the character and scope of the attached claims are claimed.

权利要求:
Claims (6)
[1]
claims
1. Recombinant DNA molecule, characterized by the fact that it consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-8, in which said DNA molecule is a diagnostic amplicon for the presence of DNA from the MON 87427 transgenic corn event, in which a representative seed sample comprising the said event was deposited as ATCC PTA-7899.
[2]
2. DNA probe for identification of the MON87427 event in biological samples, characterized by the fact that it comprises a contiguous nucleotide sequence of SEQ ID NO: 10 of sufficient length, or an integral complement of it, to function as a DNA probe that hybridizes under stringent hybridization conditions with a DNA molecule that comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-8 and SEQ ID NO: 10, and does not hybridize under stringent hybridization conditions with a DNA that does not comprise a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-8 and SEQ ID NO: 10, and wherein said DNA probe comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, in which a representative sample of seed comprising the MON 87427 event was deposited as ATCC PTA-7899.
[3]
3. Pair of DNA molecules, characterized by the fact that it consists of a first DNA molecule and a second DNA molecule different from the first DNA molecule, in which said first and second DNA molecules each comprise a nucleic acid molecule that has a nucleotide sequence of sufficient length of contiguous nucleotides of SEQ ID NO: 10, or an integral complement thereof, and wherein said first DNA molecule resides in a transgenic insert of
Petition 870180158755, of 12/05/2018, p. 4/11
2/4
DNA of SEQ ID NO: 10, and said second DNA molecule resides in a genomic corn DNA of SEQ ID NO: 10, to function as DNA primers when used together in an amplification reaction with the MON 87427 event DNA to produce a diagnostic amplicon for the MON 87427 transgenic corn event DNA in a sample, wherein said amplicon comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, wherein a representative seed sample comprising the MON 87427 event was deposited as ATCC PTA-7899.
[4]
4. Method for detecting the presence of a DNA molecule derived from a transgenic corn plant comprising the MON 87427 event in a sample, characterized by the fact that it comprises:
a) contact of a sample with the DNA probe as defined in claim 2;
b) subjecting said DNA sample and said probe to stringent hybridization conditions; and
c) detecting the hybridization of said DNA probe to a DNA molecule in said sample, wherein the hybridization of said DNA probe to said DNA molecule indicates the presence of a DNA molecule derived from the MON 87427 transgenic corn event in said sample, in which a representative sample of seed comprising the MON 87427 event was deposited as ATCC PTA7899.
[5]
5. Method for detecting the presence of a DNA molecule from a transgenic corn plant comprising the MON 87427 transgenic corn event in a sample, characterized by the fact that it comprises:
a) contact of a sample with the pair of DNA molecules
Petition 870180158755, of 12/05/2018, p. 5/11
3/4 as defined in claim 3;
b) carrying out an amplification reaction sufficient to produce a DNA amplicon comprising a sequence selected from the group consisting of SEQ ID NO: 1-8 and SEQ ID NO: 10; and
c) detecting the presence of said DNA amplicon in said reaction, in which the presence of said DNA amplicon in said reaction indicates the presence of a DNA molecule derived from a transgenic corn plant comprising the MON 87427 event in said sample, wherein a representative seed sample comprising the MON 87427 event was deposited as ATCC PTA7899.
[6]
6. DNA detection kit, characterized by the fact that it comprises:
a) a pair of DNA molecules comprising a first DNA molecule and a second DNA molecule different from the first DNA molecule, wherein said first and second DNA molecules each comprise a nucleic acid molecule that has a nucleotide sequence of sufficient length of contiguous nucleotides of SEQ ID NO: 10, and wherein said first DNA molecule resides in a transgenic DNA insert of SEQ ID NO: 10, and said second DNA molecule resides in DNA genomic corn from SEQ ID NO: 10, to function as DNA primers when used together in an amplification reaction with the MON 87427 event DNA to produce an amplicon diagnosis for the MON 87427 transgenic corn event DNA in a sample, wherein said amplicon comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2; or
b) at least one DNA diagnostic probe for the
Petition 870180158755, of 12/05/2018, p. 6/11
4/4 MON 87427 event, wherein the DNA probe comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, in which a representative seed sample comprising the MON 87427 event was deposited as ATCC PTA7899.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US20200205361A1|2020-07-02|Transgenic maize event mon 87427 and the relative development scale

---

US20220010326A1|2022-01-13|Transgenic Maize Event MON 87419 and Methods of Use Thereof

---

JP5957447B2|2016-07-27|Genetically modified oilseed rape event MON88302 and method of use thereof

---

ES2675311T3|2018-07-10|GM 87708 soybean transgenic event and procedures for its use

---

US10415101B2|2019-09-17|Methods for producing canola plants with clubroot resistance and compositions thereof

---

MX2013011275A|2013-10-17|Cotton transgenic event mon 88701 and methods of use thereof.

---

US10271487B2|2019-04-30|Methods and compositions for producing plants with elevated brix

---

KR20200093076A|2020-08-04|Corn event MON87429 and how to use it

---

EA037898B1|2021-06-03|Methods and compositions for selective regulation of protein expression

---

Dowling2015|Characterization of Overwintering Perenniality in Napiergrass: Traditional and Molecular Approaches

---

Nerland et al.2013|Preliminary environmental risk assessment of genetically modified oilseed rape MON 88302 for food and feed uses, import and processing under Regulation | No 1829/2003 |. Opinion of the Panel on Genetically Modified Organisms of the Norwegian Scientific Committee for Food Safety

同族专利:

---

公开号 | 公开日

---

AR080565A1|2012-04-18|

---

RU2623176C2|2017-06-22|

---

BR112012012404A2|2015-09-15|

---

HUE039891T2|2019-02-28|

---

RU2012126100A|2013-12-27|

---

US20110126310A1|2011-05-26|

---

EP2503872B1|2018-05-09|

---

UY33045A|2011-06-30|

---

US20140109250A1|2014-04-17|

---

EP3144391A2|2017-03-22|

---

EP2503872A1|2012-10-03|

---

CA2780448C|2018-02-13|

---

CL2012001318A1|2013-02-01|

---

ZA201203630B|2013-01-30|

---

US20200205361A1|2020-07-02|

---

RU2764586C2|2022-01-18|

---

EP3144391A3|2017-06-21|

---

GT201200157A|2014-06-02|

---

CO6541532A2|2012-10-16|

---

EP2503872A4|2013-04-24|

---

CN104969853A|2015-10-14|

---

PE20121800A1|2013-01-22|

---

MX358629B|2018-08-28|

---

US8618358B2|2013-12-31|

---

UA115762C2|2017-12-26|

---

RU2017114514A|2019-01-28|

---

WO2011062904A1|2011-05-26|

---

CA2992347A1|2011-05-26|

---

CN104969853B|2017-10-31|

---

RU2017114514A3|2021-11-01|

---

US10561083B2|2020-02-18|

---

CN103260393B|2015-05-13|

---

MX2012005906A|2012-06-19|

---

CA2780448A1|2011-05-26|

---

AP2012006325A0|2012-06-30|

---

CN103260393A|2013-08-21|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US4735649A|1985-09-25|1988-04-05|Monsanto Company|Gametocides|

---

US5506368A|1989-08-30|1996-04-09|Pioneer Hi-Bred International, Inc.|Inbred corn line PHN82|

---

US5484956A|1990-01-22|1996-01-16|Dekalb Genetics Corporation|Fertile transgenic Zea mays plant comprising heterologous DNA encoding Bacillus thuringiensis endotoxin|

---

US5495065A|1990-06-20|1996-02-27|Pioneer Hi-Bred International, Inc.|Inbred corn line PHW06|

---

US5506367A|1990-06-20|1996-04-09|Pioneer Hi-Bred International, Inc.|Inbred corn line PHP38|

---

US5543575A|1990-06-20|1996-08-06|Pioneer-Hi-Bred International, Inc.|Inbred corn line PHK46|

---

US5567861A|1990-06-20|1996-10-22|Pioneer Hi-Bred International, Inc.|Inbred corn line PHN46|

---

US5434346A|1991-02-01|1995-07-18|Pioneer Hi-Bred International, Inc.|Inbred corn line PHT11|

---

US5536900A|1991-12-16|1996-07-16|Ciba-Geigy Corporation|Inbred corn line|

---

US5557034A|1992-02-03|1996-09-17|Pioneer Hi-Bred International, Inc.|Inbred corn line PHN18|

---

US5625129A|1992-02-03|1997-04-29|Pioneer Hi-Bred International, Inc.|Inbred corn line PHDD6|

---

US5593874A|1992-03-19|1997-01-14|Monsanto Company|Enhanced expression in plants|

---

US5409823A|1992-09-24|1995-04-25|Ciba-Geigy Corporation|Methods for the production of hybrid seed|

---

US5723721A|1993-02-17|1998-03-03|Novartis Corporation|Inbred corn line CG00685 use thereof|

---

US5530181A|1993-06-16|1996-06-25|Sandoz Ltd.|Corn inbreds `899` and `901` and corn hybrid `N5220`|

---

US5489744A|1993-07-21|1996-02-06|Agrigenetrics, L.P.|Inbred corn line 4P33339|

---

US5416255A|1993-10-21|1995-05-16|Holden's Foundation Seeds, Inc.|Inbred corn line LH225|

---

US5416261A|1993-12-06|1995-05-16|Holden's Foundation Seeds, Inc.|Inbred corn lines LH185|

---

US5491286A|1994-01-24|1996-02-13|Pioneer Hi-Bred International, Inc.|Inbred corn line PHKM5|

---

US5444178A|1994-01-24|1995-08-22|Pioneer Hi-Bred International, Inc.|Inbred corn line PHHB4|

---

US5453564A|1994-01-24|1995-09-26|Pioneer Hi-Bred International, Inc.|Inbred corn line PHTE4|

---

US5527986A|1994-01-24|1996-06-18|Pioneer Hi-Bred International, Inc.|Inbred corn line PHTD5|

---

US5602317A|1994-01-24|1997-02-11|Pioneer Hi-Bred International, Inc.|Inbred corn line PHAAO|

---

US5541352A|1994-01-24|1996-07-30|Pioneer Hi-Bred International, Inc.|Inbred corn line PHRD6|

---

US5585541A|1994-02-14|1996-12-17|Zeneca Limited|Inbred corn line designated ZS1513|

---

US5563327A|1994-02-14|1996-10-08|Zeneca Limited|Inbred corn line disignated ZS0510|

---

US5569826A|1994-02-22|1996-10-29|Zeneca Limited|Inbred corn line designated ZS0114|

---

US5569813A|1994-02-22|1996-10-29|Zeneca Limited|Inbred corn line designated ZS0223|

---

US5585534A|1994-02-22|1996-12-17|Zeneca Limited|Inbred corn line designated ZS0853|

---

US5585533A|1994-02-22|1996-12-17|Zeneca Limited|Inbred corn line designated ZS0560|

---

US5731503A|1994-11-09|1998-03-24|Novartis Corporation|Inbred corn line NP 948|

---

US5545811A|1994-12-02|1996-08-13|Holden's Foundation Seeds Inc.|Inbred corn line LH189|

---

US5495067A|1994-12-02|1996-02-27|Holden's Foundation Seeds, Inc.|Inbred corn line LH252|

---

US5495068A|1994-12-05|1996-02-27|Holden's Foundation Seeds, Inc.|Inbred corn line LH231|

---

US5491296A|1994-12-05|1996-02-13|Holden's Foundation Seeds, Inc.|Inbred corn line LH176|

---

US5728924A|1995-01-19|1998-03-17|Henson; Allen R.|Inbred corn line NP 934|

---

US5608138A|1995-01-31|1997-03-04|Pioneer Hi-Bred International, Inc.|Inbred maize line PHKV1|

---

US5563322A|1995-01-31|1996-10-08|Pioneer Hi-Bred International, Inc.|Inbred maize line PHAG6|

---

US5534661A|1995-01-31|1996-07-09|Pioneer Hi-Bred International, Inc.|Inbred maize line PHKW3|

---

US5563321A|1995-01-31|1996-10-08|Pioneer Hi-Bred International, Inc.|Inbred maize line PHGF5|

---

US5545809A|1995-01-31|1996-08-13|Pioneer Hi-Bred International, Inc.|Inbred maize line PHBG4|

---

US5569816A|1995-01-31|1996-10-29|Pioneer Hi-Bred International, Inc.|Inbred maize line phajo|

---

US5545812A|1995-01-31|1996-08-13|Pioneer Hi-Bred International, Inc.|Inbred maize line PHNJ2|

---

US5563323A|1995-01-31|1996-10-08|Pioneer Hi-Bred International, Inc.|Inbred maize line PHAP9|

---

US5569818A|1995-01-31|1996-10-29|Pioneer Hi-Bred International, Inc.|Inbred maize line phap8|

---

US5563320A|1995-01-31|1996-10-08|Pioneer Hi-Bred International, Inc.|Inbred maize line PH54B|

---

US5728919A|1995-01-31|1998-03-17|Pioneer Hi-Bred International, Inc.|Inbred maize line PHBF0|

---

US5569819A|1995-01-31|1996-10-29|Pioneer Hi-Bred International, Inc.|Inbred maize line PHPP8|

---

US5639946A|1995-01-31|1997-06-17|Pioneer Hi-Bred International, Inc.|Inbred maize line PHDP0|

---

US5569817A|1995-01-31|1996-10-29|Pioneer Hi-Bred International, Inc.|Inbred maize line PHJJ3|

---

US5545813A|1995-01-31|1996-08-13|Pioneer Hi-Bred International, Inc.|Inbred maize line PHRF5|

---

US5557038A|1995-01-31|1996-09-17|Pioneer Hi-Bred International, Inc.|Inbred maize line PHTP9|

---

US5530184A|1995-01-31|1996-06-25|Pioneer Hi-Bred International, Inc.|Inbred maize line PHAP1|

---

US5563325A|1995-01-31|1996-10-08|Pioneer Hi-Bred International, Inc.|Inbred maize line PHBE2|

---

US5910635A|1995-02-03|1999-06-08|Dekalb Genetics Corporation|Inbred corn plant 91DFA-5|

---

US5731506A|1995-02-21|1998-03-24|Novartis Corporation|Inbred corn line CG00766|

---

US5585539A|1995-03-28|1996-12-17|Zeneca Limited|Inbred corn line ZS1791|

---

US5589606A|1995-03-28|1996-12-31|Zenco Limited|Inbred corn line ZS1679|

---

US5602316A|1995-03-28|1997-02-11|Zenco Limited|Inbred corn line ZS1783|

---

US5602315A|1995-03-28|1997-02-11|Zenco Limited|Inbred corn line ZS1202|

---

US5625131A|1995-03-28|1997-04-29|Zenco Limited|Inbred corn line ZSO541|

---

US5602314A|1995-03-28|1997-02-11|Zenco Limited|Inbred corn line ZS1022|

---

US5569820A|1995-03-28|1996-10-29|Zeneca Limited|Inbred corn line ZS1284|

---

US5576473A|1995-07-05|1996-11-19|Asgrow Seed Company|Inbred corn line 7054|

---

US5625132A|1995-09-01|1997-04-29|Pioneer Hi-Bred International, Inc.|Inbred maize line PH08B|

---

US5618987A|1995-09-01|1997-04-08|Pioneer Hi-Bred International, Inc.|Inbred maize line PH42B|

---

US5608139A|1995-09-01|1997-03-04|Pioneer Hi-Bred International, Inc.|Inbred maize line PHO5F|

---

US5889188A|1995-09-05|1999-03-30|Pioneer Hi-Bred International, Inc.|Inbred maize line PH0B4|

---

US5731491A|1995-09-05|1998-03-24|Pioneer Hi-Bred International, Inc.|Inbred maize line PHNG2|

---

US5675066A|1995-09-05|1997-10-07|Pioneer Hi-Bred International, Inc.|Inbred maize line PH06N|

---

US5545814A|1995-09-05|1996-08-13|Pioneer Hi-Bred International, Inc.|Inbred maize line PHFR8|

---

US5608140A|1995-09-05|1997-03-04|Pioneer Hi-Bred International, Inc.|Inbred maize line PH38B|

---

US5689034A|1995-09-05|1997-11-18|Pioneer Hi-Bred International, Inc.|Inbred maize line PH24E|

---

US5602318A|1995-09-21|1997-02-11|Pioneer Hi-Bred International, Inc.|Inbred maize line PHDG1|

---

US5625133A|1995-09-21|1997-04-29|Pioneer Hi-Bred International, Inc.|Inbred maize line PHOC7|

---

US5639941A|1995-09-26|1997-06-17|Holden's Foundation Seeds, Inc.|Inbred corn line LH226|

---

US5633428A|1995-09-26|1997-05-27|Holden's Foundation Seeds, Inc.|Inbredcorn line LH262|

---

US5684227A|1995-09-26|1997-11-04|Holden's Foundation Seeds|Inbred corn line LH177|

---

US5639943A|1995-12-04|1997-06-17|Holden's Foundation Seeds, Inc.|Inbred corn line LH234|

---

US5625135A|1995-12-04|1997-04-29|Holden's Foundation Seeds, Inc.|Inbred corn line LH233|

---

US5633429A|1995-12-04|1997-05-27|Holden's Foundation Seeds, Inc.|Inbred corn line LH227|

---

US5639942A|1995-12-04|1997-06-17|Holden's Foundation Seeds, Inc.|Inbred corn line LH235|

---

US5910625A|1996-02-01|1999-06-08|Dekalb Genetics Corporation|Inbred corn plant 3AZA1 and seeds thereof|

---

US5750829A|1996-02-23|1998-05-12|Pioneer Hi-Bred International, Inc.|Inbred maize line PHOAA|

---

US5723722A|1996-02-26|1998-03-03|Pioneer Hi-Bred International, Inc.|Inbred maize line PHND1|

---

US5750830A|1996-02-26|1998-05-12|Cunnyngham; Charles Thomas|Inbred maize line PH15A|

---

US5750832A|1996-02-28|1998-05-12|Pioneer Hi-Bred International, Inc.|Inbred maize line PH44G|

---

US5750831A|1996-02-28|1998-05-12|Pioneer Hi-Bred International, Inc.|Inbred maize line PH25A|

---

US5977451A|1996-03-05|1999-11-02|Pioneer Hi-Bred International, Inc.|Inbred maize line PHFW4|

---

US5723723A|1996-03-05|1998-03-03|Pioneer Hi-Bred International, Inc.|Inbred maize line PH44A|

---

US5723725A|1996-03-21|1998-03-03|Garst Seed Company|Inbred corn line ZS01101|

---

US5723728A|1996-03-27|1998-03-03|Garst Seed Company|Inbred corn line ZS01819|

---

US5723727A|1996-03-28|1998-03-03|Garst Seed Company|Inbred corn line ZS01429|

---

US5723726A|1996-03-28|1998-03-03|Garst Seed Company|Inbred corn line ZS01452|

---

US5723724A|1996-04-01|1998-03-03|Garst Seed Company|Inbred corn line ZS01591|

---

US6130369A|1997-03-28|2000-10-10|Dekalb Genetics Corporation|Inbred corn plant WQCD10 and seeds thereof|

---

US5977455A|1996-04-02|1999-11-02|Dekalb Genetics Corporation|Inbred corn plants WKBC5, and seeds thereof|

---

US5723729A|1996-04-08|1998-03-03|Garst Seed Company|Inbred corn line ZS01250|

---

US5856614A|1996-04-08|1999-01-05|Dekalb Genetics Corporation|Inbred corn plants 01IZB2 and seeds thereof|

---

US5977452A|1996-04-08|1999-11-02|Dekalb Genetics Corporation|Inbred corn plant 01IBH10|

---

US5723730A|1996-04-25|1998-03-03|Garst Seed Company|Inbred corn line ZS01595|

---

US5859353A|1996-05-01|1999-01-12|Cargill, Incorporated|Corn Inbred lines for dairy cattle feed|

---

US5731502A|1996-06-28|1998-03-24|Novartis Corporation|Inbred maize lines CG5NA58 and CG5NA58A|

---

US5728922A|1996-06-28|1998-03-17|Novartis Corporation|Inbred maize line CG5NA01|

---

US5728923A|1996-06-28|1998-03-17|Miller; Robert|Inbred maize line CG3ND97|

---

US5723731A|1996-07-12|1998-03-03|Asgrow Seed Company|Inbred corn line ASG05|

---

US5714671A|1996-07-12|1998-02-03|Asgrow Seed Company|Inbred corn line ASG06|

---

US5723739A|1996-10-04|1998-03-03|Holden's Foundation Seeds|Inbred corn line LH281|

---

US5731504A|1996-10-04|1998-03-24|Holden's Foundation Seeds, Inc.|Inbred corn line LH236|

---

US5917125A|1997-01-29|1999-06-29|Pioneer Hi-Bred International, Inc.|Inbred maize line PH03D|

---

US5917134A|1997-01-29|1999-06-29|Pioneer Hi-Bred International, Inc.|Inbred maize line PHDN7|

---

US5969221A|1997-02-05|1999-10-19|Dekalb Genetics Corporation|Inbred corn plant 82IUH1 and seeds thereof|

---

US5914452A|1997-02-05|1999-06-22|Dekalb Genetics Corporation|Inbred corn plant MF1113B and seeds thereof|

---

US5936145A|1997-02-05|1999-08-10|Dekalb Genetics Corporation|Inbred corn plant 87DIA4 and seeds thereof|

---

US5998710A|1997-02-05|1999-12-07|Dekalb Genetics Corporation|Inbred corn plant NL085B and seeds thereof|

---

US5977453A|1997-02-05|1999-11-02|Dekalb Genetics Corporation|Inbred corn plant 91CSI-1 and seeds thereof|

---

US5902922A|1997-02-05|1999-05-11|Dekalb Genetics Corporation|Inbred corn plant FEBS and seeds thereof|

---

US6121519A|1997-02-05|2000-09-19|Dekalb Genetics Corporation|Inbred corn plant 90DJD28 and seeds thereof|

---

US5905191A|1997-02-05|1999-05-18|Dekalb Genetics Corporation|Inbred corn plant 8F286 and seeds thereof|

---

US5969212A|1997-02-05|1999-10-19|Dekalb Genetics Corporation|Inbred corn plant 79103A1 and seeds thereof|

---

US6133512A|1997-02-05|2000-10-17|Dekalb Genetics Corporation|Inbred corn plant 17DHD5 and seeds thereof|

---

US6483014B1|1997-02-18|2002-11-19|Syngenta Participations Ag|Inbred corn line NP 2010|

---

US6114608A|1997-03-14|2000-09-05|Novartis Ag|Nucleic acid construct comprising bacillus thuringiensis cry1Ab gene|

---

US6573438B1|1997-03-14|2003-06-03|Syngenta Participations Ag|Inbred Maize line 2044BT|

---

AR012335A1|1997-04-03|2000-10-18|Dekalb Genetics Corp|TRANSGENIC FERTILIZER CORN PLANT AND METHOD FOR PREPARING IT, SUCH ENDOGAMIC AND CROSS-RAISED PLANTS RESISTANT TO GLYPHOSATE, METHODS TO GROW AND INCREASE YIELD OF CORN, PRODUCE FORAGE, FOOD FOR HUMAN BEINGS, STARCHES, AND CRIED|

---

US6040497A|1997-04-03|2000-03-21|Dekalb Genetics Corporation|Glyphosate resistant maize lines|

---

US5932787A|1997-07-29|1999-08-03|Limagrain Genetics Corporation|Inbred corn line SBB1|

---

US6077996A|1997-08-13|2000-06-20|Asgrow Seed Company|Inbred corn line ASG09|

---

US5880349A|1997-08-13|1999-03-09|Asgrow Seed Company|Inbred corn line 7571|

---

US6114606A|1997-08-26|2000-09-05|Asgrow Seed Company|Inbred corn line 3204|

---

US5910636A|1997-08-28|1999-06-08|Asgrow Seed Company|Inbred corn line ASG20|

---

US5969220A|1997-09-09|1999-10-19|Asgrow Seed Company|Inbred corn line ASG22|

---

US6060649A|1997-09-09|2000-05-09|Asgrow Seed Company|Inbred corn line AS607|

---

US5880350A|1997-09-19|1999-03-09|Holden's Foundation Seeds Inc.|Inbred corn line LH237|

---

US5965798A|1997-09-19|1999-10-12|Holden's Foundation Seeds, Inc.|Inbred corn line LH300|

---

US5986182A|1997-10-01|1999-11-16|Thompson; Steven A.|Inbred maize line 4SQ601|

---

US5912420A|1997-10-01|1999-06-15|Huang; Tzao Fen|Inbred corn line ZS03940|

---

US5936144A|1997-11-26|1999-08-10|Rufener, Ii; George Keith|Inbred corn line ZS01231|

---

US5952551A|1997-11-26|1999-09-14|Stelpflug; Richard S.|Inbred corn line ZS09247|

---

US6015944A|1997-12-09|2000-01-18|Holden's Foundation Seeds, Inc.|Inbred corn line LH284|

---

US6049030A|1997-12-09|2000-04-11|Holden's Foundation Seeds, Inc.|Inbred corn line LH286|

---

US5880348A|1997-12-09|1999-03-09|Holden's Foundation Seeds, Inc.|Inbred corn line LH273|

---

US6111171A|1998-01-26|2000-08-29|Dekalb Genetics Corporation|Inbred corn plant 90LCL6 and seeds thereof|

---

US5932788A|1998-01-26|1999-08-03|Dekalb Genetics Corporation|Inbred corn plant 86ISI3 and seeds thereof|

---

US5922935A|1998-01-26|1999-07-13|Dekalb Genetics Corporation|Inbred corn plant 82DHB1 and seeds thereof|

---

US6046387A|1998-01-30|2000-04-04|Dekalb Genetics Corporation|Inbred corn plant 17dhd7 and seeds thereof|

---

US6043417A|1998-01-30|2000-03-28|Dekalb Genetics Corporation|Inbred corn plant 79314N1 and seeds thereof|

---

US6072108A|1998-01-30|2000-06-06|Dekalb Genetics Corporation|Inbred corn plant 09DSQ1 and seeds thereof|

---

US6031162A|1998-01-30|2000-02-29|Dekalb Genetics Corporation|Inbred corn plant 90LDI1 and seeds thereof|

---

US6034304A|1998-02-02|2000-03-07|Dekalb Genetics Corporation|Inbred corn plant 90LDC2 and seeds thereof|

---

US6037531A|1998-02-02|2000-03-14|Dekalb Genetics Corporation|Inbred corn plant RDBQ2 and seeds thereof|

---

US6034305A|1998-02-03|2000-03-07|Dekalb Genetics Corporation|Inbred corn plant 90QDD1 and seeds thereof|

---

US6031161A|1998-02-04|2000-02-29|Dekalb Genetics Corporation|Inbred corn plant GM9215 and seeds thereof|

---

US5962770A|1998-02-05|1999-10-05|Dekalb Genetics Corporation|Inbred corn plant 91DHA1 and seeds thereof|

---

US5912421A|1998-02-05|1999-06-15|Dekalb Genetics Corporation|Inbred corn plant 91ISI6 and seeds thereof|

---

US5936146A|1998-02-05|1999-08-10|Dekalb Genetics Corporation|Inbred corn plant 79310J2 and seeds thereof|

---

US5994631A|1998-02-05|1999-11-30|Dekalb Genetics Corporation|Inbred corn plant WQDS2 and seeds thereof|

---

US5939606A|1998-02-05|1999-08-17|Dekalb Genetics Corporation|Inbred corn plant 01DHD10 and seeds thereof|

---

US5922936A|1998-02-05|1999-07-13|Dekalb Genetics Corporation|Inbred corn plant 8M222 and seeds thereof|

---

US5965799A|1998-02-05|1999-10-12|Dekalb Genetics Corporation|Inbred corn plant 91ISI4 and seeds thereof|

---

US6031160A|1998-02-06|2000-02-29|Dekalb Genetics Corporation|Inbred corn plant 7OLDL5 and seeds thereof|

---

US6077997A|1998-02-13|2000-06-20|Pioneer Hi-Bred International, Inc.|Inbred maize line PHOWE|

---

US5939607A|1998-02-13|1999-08-17|Pioneer Hi-Bred International, Inc.|Inbred maize line PH2CB|

---

US6118051A|1998-02-13|2000-09-12|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1NF|

---

CN1300324A|1998-03-09|2001-06-20|孟山都公司|Glyphosate as a gametocide|

---

US5942671A|1998-03-10|1999-08-24|Pioneer Hi-Bred International, Inc.|Inbred maize line PH185|

---

US5936148A|1998-03-10|1999-08-10|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1GC|

---

US5990393A|1998-03-10|1999-11-23|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1CN|

---

US6140562A|1998-03-10|2000-10-31|Pioneer Hi-Bred International, Inc.|Inbred maize line PH04G|

---

US6118053A|1998-03-10|2000-09-12|Pioneer Hi-Bred International, Inc.|Inbred maize line PH0JG|

---

US5998711A|1998-03-10|1999-12-07|Pioneer Hi-Bred International , Inc.|Inbred maize line PH09E|

---

US5977456A|1998-03-10|1999-11-02|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1M7|

---

US5929313A|1998-03-10|1999-07-27|Pioneer Hi-Bred International, Inc.|Inbred maize line PHMJ2|

---

US5939608A|1998-03-10|1999-08-17|Pioneer Hi-Bred International, Inc.|Inbred maize line PH080|

---

US5948957A|1998-03-10|1999-09-07|Pioneer Hi-Bred International, Inc.|Inbred maize line PH19V|

---

US5986185A|1998-03-10|1999-11-16|Pioneer Hi-Bred International, Inc.|Inbred maize line PH24D|

---

US6091007A|1998-03-10|2000-07-18|Pioneer Hi-Bred International, Inc.|Inbred maize line PH21T|

---

US6423888B1|1998-03-10|2002-07-23|Pioneer Hi-Bred International, Inc.|Inbred maize line PH77C|

---

US6107550A|1998-03-10|2000-08-22|Pioneer Hi-Bred International, Inc.|Inbred maize line PH0V0|

---

US5986184A|1998-03-10|1999-11-16|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1TB|

---

US6118054A|1998-03-10|2000-09-12|Pioneer Hi-Bred International, Inc.|Inbred maize line PH189|

---

US6025547A|1998-03-10|2000-02-15|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1CA|

---

US6084160A|1998-03-10|2000-07-04|Pioneer Hi-Bred International, Inc.|Inbred maize line PH0CD|

---

US5942670A|1998-03-10|1999-08-24|Pioneer Hi-Bred International, Inc.|Inbred maize line PH14T|

---

US6121520A|1998-03-10|2000-09-19|Pioneer Hi-Bred International, Inc.|Inbred maize line PH12C|

---

US6118055A|1998-03-10|2000-09-12|Pioneer Hi-Bred International, Inc.|Inbred maize line PH12J|

---

US6020543A|1998-03-10|2000-02-01|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1B5|

---

US6080919A|1998-03-11|2000-06-27|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1GG|

---

US5952552A|1998-05-28|1999-09-14|Crookham Company|Inbred sweet corn line CRAUGSH2W-89|

---

US5973238A|1998-10-01|1999-10-26|Holden's Foundation Seeds, Llc|Inbred corn line LH302|

---

US5990394A|1998-10-01|1999-11-23|Holden's Foundation Seeds, Llc|Inbred corn line LH261|

---

US5981855A|1998-10-01|1999-11-09|Holden's Foundation Seeds, Llc|Imbred corn line LH301|

---

DE69941009D1|1998-11-17|2009-07-30|Monsanto Technology Llc|PHOSPHONATE METABOLIZING PLANTS|

---

US5977460A|1998-12-04|1999-11-02|Holden's Foundation Seeds, Llc|Inbred corn line LH303|

---

US5986187A|1998-12-04|1999-11-16|Holden's Foundation Seeds, Llc|Inbred corn line LH277|

---

US5977459A|1998-12-04|1999-11-02|Holden's Foundation Seeds, Llc|Inbred corn line LH266|

---

US5986186A|1998-12-04|1999-11-16|Holden's Foundation Seeds, Llc|Inbred corn line LH229|

---

US5973239A|1998-12-04|1999-10-26|Holden's Foundation Seeds, Llc|Inbred corn line LH265|

---

US6114610A|1998-12-08|2000-09-05|Monsanto Corporation|Inbred corn line ASG27|

---

US6084161A|1998-12-08|2000-07-04|Monsanto Corporation|Inbred corn line ASG25|

---

US6103958A|1998-12-09|2000-08-15|Monsanto Corporation|Inbred corn line ASG26|

---

US6103959A|1998-12-09|2000-08-15|Monsanto Corporation|Inbred corn line ASG28|

---

US6054640A|1998-12-09|2000-04-25|Monsanto Corporation|Inbred corn line ASG29|

---

US6072109A|1998-12-29|2000-06-06|The J. C. Robinson Seed Co.|Inbred corn line JCRNR113|

---

US6040506A|1999-01-06|2000-03-21|Hoegemeyer Hybrid|Inbred corn line HX621|

---

US6043416A|1999-01-06|2000-03-28|Hoegemeyer Hybrid|Inbred corn line HX740|

---

US6040507A|1999-01-11|2000-03-21|Hoegemeyer Hybrid|Inbred corn line HX622|

---

US6043418A|1999-01-13|2000-03-28|Dekalb Genetics Corporation|Inbred corn plant 17INI20 and seeds thereof|

---

US6114611A|1999-01-14|2000-09-05|Dekalb Genetics Corporation|Inbred corn plant WDHQ2 and seeds thereof|

---

US6077999A|1999-01-14|2000-06-20|Dekalb Genetics Corporation|Inbred corn plant 86AQV2 and seeds thereof|

---

US6046388A|1999-01-14|2000-04-04|Dekalb Genetics Corporation|Inbred corn plant 83INI8 and seeds thereof|

---

US6096952A|1999-01-14|2000-08-01|Dekalb Genetics Corporation|Inbred corn plant 01DHD16 and seeds thereof|

---

US6084162A|1999-01-14|2000-07-04|Dekalb Genetics Corporation|Inbred corn plant 86ISI15 and seeds thereof|

---

US6046390A|1999-01-14|2000-04-04|Dekalb Genetics Corporation|Inbred corn plant 01INL1 and seeds thereof|

---

US6111172A|1999-01-14|2000-08-29|Dekalb Genetics Corporation|Inbred corn plant 22DHD11 and seeds thereof|

---

US6046389A|1999-01-14|2000-04-04|Dekalb Genetics Corporation|Inbred corn plant 83InI14 and seeds thereof|

---

US6040508A|1999-01-14|2000-03-21|Dekalb Genetics Corporation|Inbred corn plant 01HG12 and seeds thereof|

---

US6072110A|1999-01-19|2000-06-06|Novartis Ag|Inbred maize line NP2029|

---

US6114613A|1999-01-26|2000-09-05|Pioneer Hi-Bred International, Inc.|Inbred maize line PH3GR|

---

US6133513A|1999-01-26|2000-10-17|Pioneer Hi-Bred Intl., Inc.|Inbred maize line PH0WD|

---

US6133514A|1999-01-26|2000-10-17|Pioneer Hi-Bred International, Inc.|Inbred maize line PH3GK|

---

US6657109B1|1999-02-02|2003-12-02|Syngenta Participations Ag|Inbred maize line NP2015|

---

US6426451B1|1999-02-17|2002-07-30|Ffr Cooperative, Inc.|Inbred corn line IT201|

---

US6420634B1|1999-02-17|2002-07-16|Ffr Cooperative, Inc.|Inbred corn line 9034|

---

US6414227B1|1999-02-17|2002-07-02|Ffr Cooperative, Inc.|Inbred corn line IT302|

---

US6127609A|1999-02-24|2000-10-03|Pioneer Hi-Bred International, Inc.|Inbred maize line PH2VJ|

---

US6124529A|1999-02-25|2000-09-26|Pioneer Hi-Bred International, Inc.|Inbred maize line PH2V7|

---

US6096953A|1999-02-25|2000-08-01|Pioneer Hi-Bred International, Inc.|Inbred maize line PH224|

---

US6137036A|1999-02-25|2000-10-24|Pioneer Hi-Bred International, Inc.|Inbred maize line PH2VK|

---

US6124530A|1999-02-25|2000-09-26|Pioneer Hi-Bred International, Inc.|Inbred maize line PH4TF|

---

US6121522A|1999-02-25|2000-09-19|Pioneer Hi-Bred International, Inc.|Inbred maize line PH55C|

---

US6118056A|1999-02-25|2000-09-12|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1EM|

---

US6124535A|1999-02-26|2000-09-26|Pioneer Hi-Bred International, Inc.|Inbred maize line PH226|

---

US6124534A|1999-02-26|2000-09-26|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1K2|

---

US6124533A|1999-02-26|2000-09-26|Pioneer Hi-Bred International, Inc.|Inbred maize line PH2N0|

---

US6124531A|1999-02-26|2000-09-26|Pioneer Hi-Bred International, Inc.|Inbred maize line PH3KP|

---

US6124532A|1999-02-26|2000-09-26|Pioneer Hi-Bred International, Inc.|Inbred maize line PH2MW|

---

US6130370A|1999-03-01|2000-10-10|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1B8|

---

US6137037A|1999-03-01|2000-10-24|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1MD|

---

US6121523A|1999-03-01|2000-09-19|Pioneer Hi-Bred International, Inc.|Inbred maize line PH3EV|

---

US6127610A|1999-03-01|2000-10-03|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1M8|

---

US6140563A|1999-03-04|2000-10-31|Novartis Ag|Inbred maize line NP2151|

---

US6121525A|1999-03-17|2000-09-19|Advanta Technology Limited|Inbred corn line ZS4199|

---

US6084163A|1999-04-09|2000-07-04|Cargill Incorporated|Inbred corn line BE4547|

---

US20100293669A2|1999-05-06|2010-11-18|Jingdong Liu|Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement|

---

US6069303A|1999-05-06|2000-05-30|Holden's Foundation Seeds, Llc|Inbred corn line QH111|

---

US6137038A|1999-05-13|2000-10-24|Cargill Incorporated|Inbred corn line SM4603|

---

US5990395A|1999-05-24|1999-11-23|Novartis Ag|Inbred sweet corn line W1498A|

---

US6034306A|1999-05-24|2000-03-07|Novartis Ag|Inbred sweet corn line R398D|

---

US6908882B1|1999-09-09|2005-06-21|Monsanto Company|Enhanced method of killing weeds with glyphosate herbicide|

---

US6573361B1|1999-12-06|2003-06-03|Monsanto Technology Llc|Antifungal proteins and methods for their use|

---

US6693231B1|2000-01-24|2004-02-17|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1GD|

---

US6700041B1|2000-01-24|2004-03-02|Pioneer Hi-Bred International, Inc.|Inbred maize line PH1BC|

---

US6774289B1|2000-01-24|2004-08-10|Pioneer Hi-Bred International, Inc.|Inbred maize line PH51H|

---

US6723900B1|2000-01-24|2004-04-20|Charles Thomas Cunnyngham|Inbred maize line PHJ8R|

---

US6720486B1|2000-01-24|2004-04-13|Pioneer Hi-Bred International, Inc.|Inbred maize line PH0KT|

---

US6433259B1|2000-01-24|2002-08-13|Pioneer Hi-Bred International, Inc.|Inbred maize line PH3HH|

---

US6600095B1|2000-01-24|2003-07-29|Pioneer Hi-Bred International, Inc.|Maize PH8W4|

---

US6734348B1|2000-01-24|2004-05-11|Pioneer Hi-Bred International, Inc.|Inbred maize line PH48V|

---

US6727412B1|2000-01-25|2004-04-27|Pioneer Hi-Bred International, Inc.|Inbred maize line PH54H|

---

US6781042B1|2000-01-28|2004-08-24|Pioneer Hi-Bred International Inc.|Inbred maize line PH5FW|

---

US6437224B1|2000-01-31|2002-08-20|Asgrow Seed Company, Llc|Inbred corn plant 3323 and seeds thereof|

---

US6506965B1|2000-02-04|2003-01-14|Rustica Prograin Genetique|Inbred maize seed and plant RPK7346|

---

US6506964B1|2000-02-04|2003-01-14|Rustica Prograin Genetique|Inbred maize seed and plant RPK7250|

---

US6452075B2|2000-02-18|2002-09-17|Dekalb Genetics Corporation|Inbred corn plant GF6151 and seeds thereof|

---

US6441280B2|2000-02-18|2002-08-27|Dekalb Genetics Corporation|Inbred corn plant 16IUL6 and seeds thereof|

---

US6433261B2|2000-02-18|2002-08-13|Dekalb Genetics Corporation|Inbred corn plant 89AHD12 and seeds thereof|

---

US6455764B2|2000-02-24|2002-09-24|Dekalb Genetics Corporation|Inbred corn plant WQDS7 and seeds thereof|

---

US6444883B2|2000-02-24|2002-09-03|Asgrow Seed Company Llc|Inbred corn plant 6077 and seeds thereof|

---

US6469235B2|2000-02-24|2002-10-22|Asgrow Seed Company Llc|Inbred corn plant 3327 and seeds thereof|

---

US6452076B1|2000-02-24|2002-09-17|Asgrow Seed Company, Llc|Inbred corn plant 7180 and seeds thereof|

---

US6756527B2|2000-02-24|2004-06-29|Asgrow Seed Company Llc|Inbred corn plant 5750 and seeds thereof|

---

US6429363B1|2000-03-03|2002-08-06|Dekalb Genetics Corporation|Inbred corn plant 94INK1B and seeds thereof|

---

US6420635B1|2000-03-17|2002-07-16|Bradley Allen Sockness|Inbred corn line G1500|

---

US6441279B1|2000-03-17|2002-08-27|Advanta Technology Ltd.|Inbred corn line G1900|

---

US6426453B1|2000-03-17|2002-07-30|Advanta Technology Ltd.|Inbred corn line G3000|

---

US6407320B1|2000-04-07|2002-06-18|Illinois Foundation Seeds, Inc.|Inbred corn line FR2108|

---

US6414228B1|2000-04-12|2002-07-02|Illinois Foundation Seeds, Inc.|Inbred corn line FR3303|

---

US6420636B1|2000-04-12|2002-07-16|Illinois Foundation Seeds, Inc.|Inbred corn line FR3311|

---

US6483015B1|2000-04-12|2002-11-19|Illinois Foundation Seeds, Inc.|Inbred corn line FR3361|

---

US6410830B1|2000-04-13|2002-06-25|Illinois Foundation Seeds, Inc.|Inbred corn line FR3383|

---

US6717036B1|2000-04-27|2004-04-06|Pioneer Hi-Bred International, Inc.|Inbred maize line Ph0R8|

---

US6765132B1|2000-05-02|2004-07-20|Pioneer Hi-Bred International, Inc.|Inbred maize line PH26N|

---

BRPI0100752B1|2000-06-22|2015-10-13|Monsanto Co|DNA Molecules and Pairs of Molecules, Processes for Detecting DNA Molecules and for Creating a Glyphosate Tolerant Trait in Corn Plants, as well as DNA Detection Kit|

---

US6469232B1|2000-07-19|2002-10-22|Harris Moran Seed Company|Inbred sweet corn line 1784S|

---

US6459021B1|2000-07-19|2002-10-01|Harris Moran Seed Company|Inbred sweet corn line X532Y|

---

US6486386B1|2000-07-19|2002-11-26|Harris Moran Seed Company|Inbred sweet corn line I778S|

---

US6469233B1|2000-10-17|2002-10-22|Holden's Foundation Seeds, Llc|Inbred corn line LH176Bt810|

---

US6635808B1|2000-10-17|2003-10-21|The J C Robinson Seed Co|Inbred corn line JCR503|

---

US6635809B1|2000-10-26|2003-10-21|The J C Robinson Seed Co.|Inbred corn line NR401|

---

US6653536B1|2000-10-30|2003-11-25|Agrigenetics Inc.|Inbred corn line 5XH755|

---

US6476298B1|2000-10-30|2002-11-05|Agrigenetics Inc.|Inbred corn line 7SH382|

---

US6469234B1|2000-10-30|2002-10-22|Agrigenetics Inc.|Inbred corn line 6RC172|

---

US6433260B1|2000-10-30|2002-08-13|Agrigenetics Inc.|Inbred corn line 6TR512|

---

US6444881B1|2000-10-30|2002-09-03|Agrigenetics Inc.|Inbred corn line 7RN401|

---

AU3089902A|2000-10-30|2002-05-15|Monsanto Technology Llc|Canola event pv-bngt04 and compositions and methods for detection thereof|

---

US6617500B1|2000-11-01|2003-09-09|The J C Robinson Seed Co.|Inbred corn line M42618|

---

US6723901B1|2000-11-07|2004-04-20|Syngenta Participations Ag|Inbred maize line NP2052|

---

US6765133B2|2000-11-30|2004-07-20|Limagrain Genetics Grande Culture Sa|Inbred corn line RII1|

---

US6452074B1|2000-11-30|2002-09-17|Limagrain Genetics Grande Culture S.A.|Inbred corn line TDC1|

---

US6753465B2|2000-11-30|2004-06-22|Limagrain Genetics Grande Culture Sa|Inbred corn line MNI1|

---

US6444882B1|2000-11-30|2002-09-03|Limagrain Genetics Grande Culture Sa|Inbred corn line UBB3|

---

US6683234B1|2000-12-04|2004-01-27|Holden's Foundation Seeds, Llc|Inbred corn line LH320|

---

US6664451B1|2000-12-04|2003-12-16|Holden's Foundation Seeds, Llc|Inbred corn line LH310|

---

US6730833B1|2000-12-04|2004-05-04|Holden's Foundation Seeds, Llc|Inbred corn line LH254|

---

US6812386B1|2000-12-04|2004-11-02|Holden's Foundation Seeds, Llc|Inbred corn line LH246|

---

US6693232B1|2000-12-04|2004-02-17|Holden's Foundation Seeds, Llc|Inbred corn line LH295|

---

US6646188B1|2000-12-29|2003-11-11|Euralis Usa S.A.|Inbred maize seed and plant PSA104|

---

US6653537B2|2001-01-09|2003-11-25|Stine Seed Farm Inc.|Inbred corn line 1445-008-1|

---

US6730835B1|2001-01-11|2004-05-04|Pioneer Hi-Bred International, Inc.|Inbred maize line PH7CH|

---

US6717037B1|2001-01-11|2004-04-06|Pioneer Hi-Bred International, Inc.|Inbred maize line PH581|

---

US6809240B1|2001-01-11|2004-10-26|Poineer Hi-Bred International, Inc.|Inbred maize line PH6JM|

---

US6737566B1|2001-01-11|2004-05-18|Pioneer Hi-Bred International, Inc.|Inbred maize line PH3PV|

---

US6730834B1|2001-01-11|2004-05-04|Pioneer Hi-Bred International, Inc.|Inbred maize line PH5WB|

---

US6720487B1|2001-01-11|2004-04-13|Pioneer Hi-Bred International, Inc.|Inbred maize line PH4GP|

---

US6717038B1|2001-01-11|2004-04-06|Pioneer Hi-Bred International, Inc.|Inbred maize line PH6WR|

---

US6723902B1|2001-01-11|2004-04-20|Pioneer Hi-Bred International, Inc.|Inbred maize line PH7CP|

---

US6723903B1|2001-01-12|2004-04-20|Pioneer Hi-Bred International, Inc.|Inbred maize line PH6WG|

---

US7186902B2|2001-01-12|2007-03-06|Pioneer Hi-Bred International, Inc.|Inbred maize line PH0GC|

---

US6806408B1|2001-01-12|2004-10-19|Pioneer Hi-Bred International, Inc.|Inbred maize line PH5TG|

---

US6706954B1|2001-01-12|2004-03-16|Pioneer Hi-Bred International, Inc.|Inbred maize line PH4V6|

---

US6730836B1|2001-01-12|2004-05-04|Pioneer Hi-Bred International, Inc.|Inbred maize line PH54M|

---

US6740796B1|2001-01-12|2004-05-25|Pioneer Hi-Bred International, Inc.|Inbred maize line PH7JB|

---

US6756528B1|2001-01-12|2004-06-29|Pioneer Hi-Bred International, Inc.|Inbred maize line PH6KW|

---

US6727413B1|2001-01-12|2004-04-27|Pioneer Hi-Bred International, Inc.|Inbred maize line PH5DR|

---

US6717040B1|2001-01-12|2004-04-06|Pioneer Hi-Bred International, Inc.|Inbred maize line PH5W4|

---

US6759578B1|2001-01-12|2004-07-06|Pioneer Hi-Bred International, Inc.|Inbred maize line PH6ME|

---

US6717039B1|2001-01-12|2004-04-06|Pioneer Hi-Bred International, Inc.|Inbred maize line PH5HK|

---

US6730837B1|2001-01-12|2004-05-04|Pioneer Hi-Bred International, Inc.|Inbred maize line PH726|

---

US6740795B1|2001-01-12|2004-05-25|Pioneer Hi-Bred International, Inc.|Inbred maize line PH77V|

---

US6635810B1|2001-01-22|2003-10-21|Agrigenetics Inc.|Inbred corn line 4VP500|

---

US6759579B2|2001-01-26|2004-07-06|Syngenta Participations Ag|Inbred maize line NP2171|

---

US6646187B2|2001-01-26|2003-11-11|Syngenta Participations Ag|Inbred maize line NP2073|

---

US6459022B1|2001-01-29|2002-10-01|Dekalb Genetics Corporation|Plants and seeds of corn variety I465837|

---

US6420637B1|2001-01-29|2002-07-16|Asgrow Seed Company L.L.C.|Plants and seeds of corn variety I389972|

---

US6444884B1|2001-01-29|2002-09-03|Dekalb Genetics Corporation|Plants and seeds of corn variety I014738|

---

US6433262B1|2001-01-29|2002-08-13|Dekalb Genetics Corporation|Plants and seeds of corn variety I889291|

---

US6492581B1|2001-01-29|2002-12-10|Dekalb Genetics Corporation|Plants and seeds of corn variety I362697|

---

US6809244B1|2001-02-16|2004-10-26|Dekalb Genetics Corporation|Plants and seeds of corn variety I363128|

---

US6806409B1|2001-02-16|2004-10-19|Dekalb Genetics Corporation|Plants and seeds of corn variety 1501150|

---

US6476299B1|2001-02-16|2002-11-05|Dekalb Genetics Corporation|Plants and seeds of corn variety I181664|

---

US6806410B1|2001-02-20|2004-10-19|Asgrow Seed Company Llc|Plants and seeds of corn variety I390186|

---

US20040098768A1|2001-03-15|2004-05-20|Dick Stelpflug|Inbred corn line g3001|

---

US6677509B2|2001-03-16|2004-01-13|Ffr Cooperative|Inbred corn line RR728-18|

---

US6797869B2|2001-04-18|2004-09-28|Limagrain Genetics Grande Culture Sa|Inbred corn line RBO1|

---

US6747194B2|2001-04-18|2004-06-08|Limagrain Genetics Grande Culture Sa|Inbred corn line RAA1|

---

US6747195B2|2001-04-24|2004-06-08|Limagrain Genetics Grande Culture Sa|Inbred corn line VMM1|

---

US6809243B2|2001-05-14|2004-10-26|Kws Saat Ag|Inbred corn line KW4636|

---

US6632986B2|2001-07-18|2003-10-14|Agrigenetics Inc.|Inbred corn line BE4207|

---

US6642440B2|2001-08-03|2003-11-04|Agrigenetics Inc.., D/B/A Mycogen Seeds|Inbred corn line 7SH385|

---

US6660916B2|2001-08-03|2003-12-09|Agrigenetics, Inc.|Inbred corn line 7SH383|

---

US6670531B2|2001-08-29|2003-12-30|Harris Moran Seed Company|Inbred sweet corn line I880S|

---

US6627800B2|2001-09-07|2003-09-30|Agrigenetics Inc.|Inbred corn line 3JP286|

---

US6686519B2|2001-09-12|2004-02-03|Agrigenetics, Inc.|Inbred corn line 11084BM|

---

US6686520B2|2001-09-17|2004-02-03|J. C. Robinson Seed Co.|Inbred corn line W60028|

---

US6632987B2|2001-09-21|2003-10-14|The J C Robinson Seed Co.|Inbred corn line CI9805|

---

US6624345B2|2001-10-01|2003-09-23|Agrigenetics, Inc.|Inbred corn line MV7100|

---

US6812387B2|2001-10-09|2004-11-02|Agrigenetics Inc.|Inbred corn line 2JK221|

---

US7183470B2|2001-12-04|2007-02-27|Holden's Foundation Seeds, Llc|Inbred corn line LH321|

---

US7169983B2|2001-12-28|2007-01-30|Monsanto Technology Llc|Plants and seeds of high oil corn variety HOI001|

---

US7161069B2|2001-12-28|2007-01-09|Monsanto Technology Llc|Plants and seeds of high oil corn variety HOI002|

---

US6706955B2|2002-01-23|2004-03-16|Syngenta Participations Ag|Inbred maize line NP2276|

---

US6710233B2|2002-01-23|2004-03-23|Syngenta Participations Ag|Inbred maize line NP2222|

---

US6740797B2|2002-01-23|2004-05-25|Syngenta Participations Ag|Inbred maize line NP2316|

---

US6642441B2|2002-01-23|2003-11-04|Kws Kleinwanzlebener Saatzucgt Ag|Inbred corn line KW4773|

---

US6784348B2|2002-01-23|2004-08-31|Kws Kleinwanzlebener Saatzucgt Ag|Inbred corn line KW7606|

---

US6759580B1|2002-01-28|2004-07-06|Pioneer Hi-Bred International, Inc.|Inbred maize line PH87H|

---

US6777599B1|2002-01-28|2004-08-17|Pioneer Hi-Bred International, Inc.|Inbred maize line PH7AB|

---

US6756530B1|2002-01-28|2004-06-29|Pioneer Hi-Bred International, Inc.|Inbred maize line PH951|

---

US6784349B1|2002-01-28|2004-08-31|Pioneer Hi-Bred International, Inc.|Inbred maize line PH8CW|

---

US6784350B1|2002-01-28|2004-08-31|Pioneer Hi-Bred International, Inc.|Inbred maize line PH8PG|

---

US6781043B1|2002-01-28|2004-08-24|Pioneer Hi-Bred International, Inc.|Inbred maize line PH75K|

---

US6747196B1|2002-01-28|2004-06-08|Pioneer Hi-Bred International, Inc.|Inbred maize line PH3RC|

---

US6740798B1|2002-01-28|2004-05-25|Pioneer Hi-Breed International, Inc.|Inbred maize line PH70R|

---

US6770802B1|2002-01-28|2004-08-03|Pioneer Hi-Bred International, Inc.|Inbred maize line PH9AH|

---

US6774290B1|2002-01-31|2004-08-10|Pioneer Hi-Bred International, Inc.|Inbred maize line PH94T|

---

US20030177544A1|2002-03-13|2003-09-18|Mike Buendgen|Inbred corn line G1102|

---

US7094954B2|2002-03-13|2006-08-22|Syngenta Limited|Inbred corn line G0502|

---

MXPA05000758A|2002-07-18|2005-04-28|Monsanto Technology Llc|Methods for using artificial polynucleotides and compositions thereof to reduce transgene silencing.|

---

US20040068771A1|2002-10-07|2004-04-08|Hoegemeyer Thomas Christian|Inbred corn line HX879|

---

US6803509B2|2002-10-07|2004-10-12|Curry Seeds|Inbred corn line 9SM990|

---

US6967656B2|2002-10-28|2005-11-22|Syngenta Participations Ag|Growing degree unit meter and method|

---

US6989477B2|2002-10-31|2006-01-24|Ffr Cooperative|Inbred corn line 5020|

---

US20040088767A1|2002-10-31|2004-05-06|Steidl Robert P.|Inbred corn line 6803|

---

US6911588B2|2002-12-03|2005-06-28|Agrigentics, Inc.|Inbred corn line 6RT321|

---

US7157624B2|2002-12-05|2007-01-02|Monsanto Technology, L.L.C.|Plants and seeds of corn variety LHE323|

---

US7166776B2|2002-12-05|2007-01-23|Monsanto Technology, L.L.C.|Plants and seeds of corn variety LH311|

---

US7166777B2|2002-12-05|2007-01-23|Monsanto Technology, L.L.C.|Plants and seeds of corn variety LH351|

---

US7148410B2|2002-12-05|2006-12-12|Monsanto Technology, L.L.C.|Plants and seeds of corn variety LH306|

---

US7151208B2|2002-12-05|2006-12-19|Monsanto Technology, L.L.C.|Plants and seeds of corn variety LH268|

---

US20040123352A1|2002-12-23|2004-06-24|Plaisted Douglas C.|Inbred maize line 402A|

---

US7202401B2|2003-01-09|2007-04-10|Syngenta Participations Ag|Inbred maize line 366C|

---

US7098389B2|2003-01-16|2006-08-29|Syngenta Participations Ag|Inbred maize line NP2315|

---

US7138571B2|2003-07-14|2006-11-21|Agrigenetics, Inc.|Inbred corn line SE8505|

---

US20050028236A1|2003-07-30|2005-02-03|Metz Grant Loyal|Inbred corn line D201|

---

US7273970B2|2003-10-03|2007-09-25|Agrigenetics|Inbred corn line BE1146BMR|

---

US7135629B2|2003-12-03|2006-11-14|Agrigenetics Inc.|Inbred corn line 4XP811|

---

US7259300B2|2003-12-03|2007-08-21|Agrigenetics, Inc.|Inbred corn line 6XN442|

---

US7176361B2|2003-12-11|2007-02-13|Agrigenetics Inc|Inbred corn line BE9514|

---

US7235721B2|2003-12-11|2007-06-26|Agrigenetics, Inc.|Inbred corn line MN7224|

---

US8212113B2|2003-12-15|2012-07-03|Monsanto Technology Llc|Corn plant Mon88017 and compositions and methods for detection thereof|

---

US7166783B2|2004-01-21|2007-01-23|Syngenta Participations Ag|Inbred maize line NP2391|

---

US7091406B2|2004-01-30|2006-08-15|Pioneer Hi-Bred International, Inc.|Inbred corn line PH8WD|

---

US20050177904A1|2004-02-10|2005-08-11|Central Golden Harvest Research, Inc.|Inbred corn line D603|

---

US20050177896A1|2004-02-10|2005-08-11|Central Golden Harvest Research, Inc.|Inbred corn line D601|

---

US20050177894A1|2004-02-10|2005-08-11|Central Golden Harvest Research, Inc.|Inbred corn line D501|

---

US7790967B2|2004-06-04|2010-09-07|Agrigenetics, Inc.|Inbred corn line BS112|

---

US7094955B2|2004-06-08|2006-08-22|The J.C. Robinson Seed Co.|Inbred corn line N61060|

---

US7109404B2|2004-06-08|2006-09-19|The J.C. Robinson Seed Co.|Inbred corn line M10138|

---

US7112730B2|2004-06-08|2006-09-26|The J.C. Robinson Seed Co.|Inbred corn line W16090|

---

US7122726B2|2004-08-31|2006-10-17|Syngenta Participations Ag|Inbred maize line NP2460|

---

US7361812B2|2005-01-31|2008-04-22|Pioneer Hi-Bred International, Inc.|Inbred corn line PHB8V|

---

US7375263B2|2005-01-31|2008-05-20|Pioneer Hi-Bred International, Inc.|Inbred corn line PHCCW|

---

US7312385B2|2005-01-31|2007-12-25|Pioneer Hi-Bred International, Inc.|Inbred corn line PHCPR|

---

US7332658B2|2005-01-31|2008-02-19|Pioneer Hi-Bred International, Inc.|Inbred corn line PHCA5|

---

US7273973B2|2005-01-31|2007-09-25|Pioneer Hi-Bred International, Inc.|Inbred corn line PHEHG|

---

US7193144B2|2005-01-31|2007-03-20|Pioneer Hi-Bred International, Inc.|Inbred corn line PHCJP|

---

US7355105B2|2005-01-31|2008-04-08|Pioneer Hi-Bred International, Inc.|Inbred corn line PHC77|

---

US20050114945A1|2005-01-31|2005-05-26|Pioneer Hi-Bred International, Inc.|Inbred corn line PHCK5|

---

US7271326B2|2005-01-31|2007-09-18|Pioneer Hi-Bred International, Inc.|Inbred corn line PHAR1|

---

US7235723B2|2005-01-31|2007-06-26|Pioneer Hi-Bred International, Inc.|Inbred corn line PHCAM|

---

US7071395B2|2005-01-31|2006-07-04|Pioneer Hi-Bred International, Inc.|Inbred com line PHACV|

---

US7078602B2|2005-01-31|2006-07-18|Pioneer Hi-Bred International, Inc.|Inbred corn line PHCMV|

---

US7074991B2|2005-01-31|2006-07-11|Pioneer Hi-Bred International, Inc.|Inbred corn line PHB00|

---

US7071396B2|2005-01-31|2006-07-04|Pioneer Hi-Bred International, Inc.|Inbred corn line PHCEG|

---

US7078601B2|2005-01-31|2006-07-18|Pioneer Hi-Bred International, Inc.|Inbred corn line PHCND|

---

US7087822B2|2005-01-31|2006-08-08|Pioneer Hi-Bred International, Inc.|Inbred corn line PHADA|

---

US7164070B2|2005-01-31|2007-01-16|Pioneer Hi-Bred International, Inc.|Inbred corn line PHCER|

---

EA023885B1|2005-10-13|2016-07-29|МОНСАНТО ТЕКНОЛОДЖИ, ЭлЭлСи|Recombinant dna construct for inducing sterility in a transgenic plant, sterile transgenic plants and methods for producing hybrid seed|

---

ZA200803234B|2005-10-13|2009-01-28|Monsanto Technology Llc|Methods for producing hybrid seed|

---

US7491813B2|2005-12-07|2009-02-17|Monsanto Technology Llc|Promoter polynucleotides identified from Zea mays for use in plants|

---

US7335825B2|2006-01-31|2008-02-26|Pioneer Hi-Bred International, Inc.|Inbred corn line PHF1J|

---

US7332660B2|2006-01-31|2008-02-19|Pioneer Hi-Bred International, Inc.|Inbred corn line PHC78|

---

US7317153B2|2006-01-31|2008-01-08|Pioneer Hi-Bred International, Inc.|Inbred corn line PHEED|

---

US7317149B2|2006-01-31|2008-01-08|Pioneer Hi-Bred International, Inc.|Inbred corn line PHDPP|

---

US7317147B2|2006-01-31|2008-01-08|Pioneer Hi-Bred International, Inc.|Inbred corn line PHEDR|

---

US7227063B2|2006-01-31|2007-06-05|Pioneer Hi-Bred International, Inc.|Inbred corn line PHDWA|

---

US7335824B2|2006-01-31|2008-02-26|Pioneer Hi-Bred International, Inc.|Inbred corn line PHEJW|

---

US7301082B2|2006-01-31|2007-11-27|Pioneer Hi-Bred International, Inc.|Inbred corn line PHEBA|

---

US7319183B2|2006-01-31|2008-01-15|Pioneer Hi-Bred International, Inc.|Inbred corn line PHEGV|

---

US7335823B2|2006-01-31|2008-02-26|Pioneer Hi-Bred International, Inc.|Inbred corn line PHE67|

---

US7297850B2|2006-01-31|2007-11-20|Pioneer Hi-Bred International, Inc.|Inbred corn line PHAPT|

---

US7317152B2|2006-01-31|2008-01-08|Pioneer Hi-Bred International, Inc.|Inbred corn line PH8T0|

---

US7314989B2|2006-01-31|2008-01-01|Pioneer Hi-Bred International, Inc.|Inbred maize line PHE35|

---

US7317150B2|2006-01-31|2008-01-08|Pioneer Hi-Bred International, Inc.|Inbred corn line PHEHC|

---

US7321089B2|2006-01-31|2008-01-22|Pioneer Hi-Bred International, Inc.|Inbred corn line PHDRW|

---

US7317151B2|2006-01-31|2008-01-08|Pioneer Hi-Bred International, Inc.|Inbred corn line PHANF|

---

US7314990B2|2006-01-31|2008-01-01|Pioneer Hi-Bred International, Inc.|Inbred corn line PHEHR|

---

US7304222B2|2006-01-31|2007-12-04|Pioneer Hi-Bred International, Inc.|Inbred corn line PHENE|

---

US7227064B2|2006-01-31|2007-06-05|Pioneer Hi-Bred International, Inc.|Inbred corn line PH8JV|

---

US7317148B2|2006-01-31|2008-01-08|Pioneer Hi-Bred International, Inc.|Inbred corn line PHE72|

---

US7332659B2|2006-01-31|2008-02-19|Pioneer Hi-Bred International, Inc.|Inbred corn line PHEWW|

---

KR101366363B1|2006-05-26|2014-02-21|몬산토 테크놀로지 엘엘씨|Corn plant and seed corresponding to transgenic event mon89034 and methods for detection and use thereof|

---

US9309528B2|2006-11-21|2016-04-12|The Samuel Roberts Noble Foundation, Inc.|Biofuel production methods and compositions|

---

US8158850B2|2007-12-19|2012-04-17|Monsanto Technology Llc|Method to enhance yield and purity of hybrid crops|

---

CA2712445C|2008-02-15|2018-11-06|Monsanto Technology Llc|Soybean plant and seed corresponding to transgenic event mon87769 and methods for detection thereof|

---

MY176497A|2009-03-30|2020-08-12|Monsanto Technology Llc|Transgenic rice event 17314 and methods of use thereof|

---

KR101818775B1|2009-03-30|2018-01-15|몬산토 테크놀로지 엘엘씨|Rice transgenic event 17053 and methods of use thereof|

---

ES2866126T3|2009-09-17|2021-10-19|Monsanto Technology Llc|MON 87708 GM soy event and procedures for its use|

---

CA2992347A1|2009-11-23|2011-05-26|Monsanto Technology Llc|Transgenic maize event mon 87427 and the relative development scale|

---

PE20141518A1|2011-07-01|2014-11-17|Monsanto Technology Llc|METHODS AND COMPOSITIONS FOR THE SELECTIVE REGULATION OF PROTEIN EXPRESSION|MXPA05000758A|2002-07-18|2005-04-28|Monsanto Technology Llc|Methods for using artificial polynucleotides and compositions thereof to reduce transgene silencing.|

---

EA023885B1|2005-10-13|2016-07-29|МОНСАНТО ТЕКНОЛОДЖИ, ЭлЭлСи|Recombinant dna construct for inducing sterility in a transgenic plant, sterile transgenic plants and methods for producing hybrid seed|

---

US8097712B2|2007-11-07|2012-01-17|Beelogics Inc.|Compositions for conferring tolerance to viral disease in social insects, and the use thereof|

---

ES2866126T3|2009-09-17|2021-10-19|Monsanto Technology Llc|MON 87708 GM soy event and procedures for its use|

---

US8962584B2|2009-10-14|2015-02-24|Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd.|Compositions for controlling Varroa mites in bees|

---

CA2992347A1|2009-11-23|2011-05-26|Monsanto Technology Llc|Transgenic maize event mon 87427 and the relative development scale|

---

BR112012022570A2|2010-03-08|2015-10-06|Monsato Technology Llc|polynucleotide molecules for gene regulation in plants.|

---

JP2014503503A|2010-11-29|2014-02-13|バイエル・インテレクチユアル・プロパテイー・ゲー・エム・ベー・ハー|α, β-unsaturated imines|

---

AU2011334989A1|2010-12-01|2013-06-13|Bayer Intellectual Property Gmbh|Use of fluopyram for controlling nematodes in crops and for increasing yield|

---

EP2460407A1|2010-12-01|2012-06-06|Bayer CropScience AG|Agent combinations comprising pyridylethyl benzamides and other agents|

---

BR112013022998A2|2011-03-10|2018-07-03|Bayer Ip Gmbh|method to improve seed germination.|

---

EP3292761A1|2011-03-23|2018-03-14|Bayer Intellectual Property GmbH|Active compound combinations|

---

CN103517900A|2011-04-08|2014-01-15|拜耳知识产权有限责任公司|Fungicide hydroximoyl-tetrazole derivatives|

---

MX346208B|2011-04-22|2017-03-09|Bayer Ip Gmbh|Active compound combinations comprising a carboxamide derivative and a fungicidal compound.|

---

US9018479B2|2011-05-05|2015-04-28|Monsanto Technology Llc|Plants and seeds of hybrid corn variety CH482678|

---

ES2699258T3|2011-06-14|2019-02-08|Bayer Cropscience Ag|Use of an enaminocarbonyl compound in combination with a biological control agent|

---

PE20141518A1|2011-07-01|2014-11-17|Monsanto Technology Llc|METHODS AND COMPOSITIONS FOR THE SELECTIVE REGULATION OF PROTEIN EXPRESSION|

---

EP2748323B1|2011-08-22|2019-05-01|BASF Agricultural Solutions Seed US LLC|Methods and means to modify a plant genome|

---

EP2561759A1|2011-08-26|2013-02-27|Bayer Cropscience AG|Fluoroalkyl-substituted 2-amidobenzimidazoles and their effect on plant growth|

---

CN103874681B|2011-09-12|2017-01-18|拜耳知识产权有限责任公司|Fungicidal 4-substituted-3-{phenyl[imino]methyl}-1,2,4-oxadizol-5-one derivatives|

---

US10760086B2|2011-09-13|2020-09-01|Monsanto Technology Llc|Methods and compositions for weed control|

---

WO2013040033A1|2011-09-13|2013-03-21|Monsanto Technology Llc|Methods and compositions for weed control|

---

CN103975068A|2011-09-13|2014-08-06|孟山都技术公司|Methods and compositions for weed control|

---

UA116089C2|2011-09-13|2018-02-12|Монсанто Текнолоджи Ллс|Methods and compositios for weed control|

---

US10806146B2|2011-09-13|2020-10-20|Monsanto Technology Llc|Methods and compositions for weed control|

---

US10829828B2|2011-09-13|2020-11-10|Monsanto Technology Llc|Methods and compositions for weed control|

---

UA115535C2|2011-09-13|2017-11-27|Монсанто Текнолоджи Ллс|Methods and compositions for weed control|

---

US9840715B1|2011-09-13|2017-12-12|Monsanto Technology Llc|Methods and compositions for delaying senescence and improving disease tolerance and yield in plants|

---

CA2848695A1|2011-09-13|2013-03-21|Monsanto Technology Llc|Methods and composition for weed control comprising inhibiting ppg oxidase|

---

US9920326B1|2011-09-14|2018-03-20|Monsanto Technology Llc|Methods and compositions for increasing invertase activity in plants|

---

AR087874A1|2011-09-16|2014-04-23|Bayer Ip Gmbh|USE OF ACILSULPHONAMIDES TO IMPROVE THE PERFORMANCE OF PLANTS|

---

CN103781352A|2011-09-16|2014-05-07|拜耳知识产权有限责任公司|Use of phenylpyrazolin-3-carboxylates for improving plant yield|

---

UA113967C2|2011-09-16|2017-04-10|APPLICATION OF 5-PHENYL OR 5-BENZYL-2-ISOXAZOLINE-3-CARBOXYLATES TO IMPROVE PLANT PRODUCTIVITY|

---

IN2014DN03473A|2011-10-04|2015-06-05|Bayer Ip Gmbh|

---

WO2013075817A1|2011-11-21|2013-05-30|Bayer Intellectual Property Gmbh|Fungicide n-[methyl]-carboxamide derivatives|

---

CN105906567B|2011-11-30|2019-01-22|拜耳知识产权有限责任公司|Antifungal N- bicyclic alkyl and N- tricyclic alkylcarboxamide derivative|

---

CN104270946B|2011-12-19|2017-05-10|拜耳农作物科学股份公司|Use of anthranilic acid diamide derivatives for pest control in transgenic crops|

---

TWI557120B|2011-12-29|2016-11-11|拜耳知識產權公司|Fungicidal 3-[methyl]-2-substituted-1,2,4-oxadiazol-5-one derivatives|

---

TWI558701B|2011-12-29|2016-11-21|拜耳知識產權公司|Fungicidal 3-[methyl]-2-sub stituted-1,2,4-oxadiazol-5-one derivatives|

---

WO2013110594A1|2012-01-25|2013-08-01|Bayer Intellectual Property Gmbh|Active compound combinations containing fluopyram and biological control agent|

---

JP6182158B2|2012-01-25|2017-08-16|バイエル・インテレクチュアル・プロパティ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングＢａｙｅｒ Ｉｎｔｅｌｌｅｃｔｕａｌ Ｐｒｏｐｅｒｔｙ ＧｍｂＨ|Active compound combination comprising fluopyram, Bacillus and a biological control agent|

---

JP6093381B2|2012-02-27|2017-03-08|バイエル・インテレクチュアル・プロパティ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングＢａｙｅｒ Ｉｎｔｅｌｌｅｃｔｕａｌ Ｐｒｏｐｅｒｔｙ ＧｍｂＨ|Active compound combination containing thiazolyl isoxazoline and fungicide|

---

WO2013139949A1|2012-03-23|2013-09-26|Bayer Intellectual Property Gmbh|Compositions comprising a strigolactame compound for enhanced plant growth and yield|

---

WO2013153143A1|2012-04-12|2013-10-17|Bayer Cropscience Ag|N-acyl- 2 -alkylpyrrolidines and piperidines useful as fungicides|

---

CN104428294B|2012-04-20|2017-07-14|拜尔农科股份公司|N cycloalkyl N [ methylene]carboxamide derivative|

---

CN104244717A|2012-04-20|2014-12-24|拜尔农科股份公司|N-cycloalkyl-n-[methylene]-carboxamide derivatives|

---

BR112014027503A2|2012-05-08|2017-08-08|Monsanto Technology Llc|mon corn event 87411|

---

EP2662361A1|2012-05-09|2013-11-13|Bayer CropScience AG|Pyrazol indanyl carboxamides|

---

EP2662364A1|2012-05-09|2013-11-13|Bayer CropScience AG|Pyrazole tetrahydronaphthyl carboxamides|

---

JP6326043B2|2012-05-09|2018-05-16|バイエル・クロップサイエンス・アクチェンゲゼルシャフト|5-halogenopyrazole indanyl carboxamides|

---

EP2662360A1|2012-05-09|2013-11-13|Bayer CropScience AG|5-Halogenopyrazole indanyl carboxamides|

---

EP2662362A1|2012-05-09|2013-11-13|Bayer CropScience AG|Pyrazole indanyl carboxamides|

---

EP2662363A1|2012-05-09|2013-11-13|Bayer CropScience AG|5-Halogenopyrazole biphenylcarboxamides|

---

EP2662370A1|2012-05-09|2013-11-13|Bayer CropScience AG|5-Halogenopyrazole benzofuranyl carboxamides|

---

MX2014013497A|2012-05-09|2015-02-10|Bayer Cropscience Ag|Pyrazole indanyl carboxamides.|

---

AR091104A1|2012-05-22|2015-01-14|Bayer Cropscience Ag|COMBINATIONS OF ACTIVE COMPOUNDS THAT INCLUDE A LIPO-CHYTOOLIGOSACARIDE DERIVATIVE AND A NEMATICIDE, INSECTICIDE OR FUNGICIDE COMPOUND|

---

US10240161B2|2012-05-24|2019-03-26|A.B. Seeds Ltd.|Compositions and methods for silencing gene expression|

---

EP2854549B1|2012-05-30|2018-08-01|Bayer Cropscience AG|Composition comprising a biological control agent and fluopicolide|

---

MX356530B|2012-05-30|2018-06-01|Bayer Cropscience Ag|Composition comprising a biological control agent and a fungicide selected from inhibitors of amino acid or protein biosynthesis, inhibitors of atp production and inhibitors of the cell wall synthesis.|

---

NZ742943A|2012-05-30|2019-04-26|Bayer Cropscience Ag|Compositions comprising a biological control agent and a fungicide from the group consisting of inhibitors of the respiratory chain at complex i or ii|

---

ES2689896T3|2012-05-30|2018-11-16|Bayer Cropscience Ag|Composition comprising a biological control agent and a fungicide|

---

US9585399B2|2012-05-30|2017-03-07|Bayer Cropscience Ag|Compositions comprising a biological control agent and an insecticide|

---

WO2013178650A1|2012-05-30|2013-12-05|Bayer Cropscience Ag|Composition comprising a biological control agent and a fungicide selected from inhibitors of the respiratory chain at complex iii|

---

CN104507319B|2012-05-30|2018-08-03|拜尔农作物科学股份公司|Include the composition of biocontrol agent and the fungicide selected from lipid film synthetic inhibitor, melanocyte biosynthesis inhibitor, nucleic acid synthetic inhibitor or signal transduction inhibitor|

---

JP6285423B2|2012-05-30|2018-02-28|バイエル・クロップサイエンス・アクチェンゲゼルシャフト|Composition comprising a biopesticide and an insecticide|

---

WO2014019983A1|2012-07-31|2014-02-06|Bayer Cropscience Ag|Compositions comprising a pesticidal terpene mixture and an insecticide|

---

MX369284B|2012-09-14|2019-11-04|Bayer Cropscience Lp|Hppd variants and methods of use.|

---

EP2719280A1|2012-10-11|2014-04-16|Bayer CropScience AG|Use of N-phenylethylpyrazole carboxamide derivatives or salts thereof for resistance management of phytopathogenic fungi|

---

EP2908620A4|2012-10-18|2016-07-27|Monsanto Technology Llc|Methods and compositions for plant pest control|

---

UA114647C2|2012-10-19|2017-07-10|Байєр Кропсайнс Аг|Method for enhancing tolerance to abiotic stress in plants using carboxamide or thiocarboxamide derivatives|

---

EP2908641B1|2012-10-19|2018-01-10|Bayer Cropscience AG|Method for treating plants against fungi resistant to fungicides using carboxamide or thiocarboxamide derivatives|

---

UA114822C2|2012-10-19|2017-08-10|Байєр Кропсайнс Аг|Active compound combinations comprising carboxamide derivatives|

---

EP2908640B1|2012-10-19|2019-10-02|Bayer Cropscience AG|Method of plant growth promotion using carboxamide derivatives|

---

EP2735231A1|2012-11-23|2014-05-28|Bayer CropScience AG|Active compound combinations|

---

BR112015012473A2|2012-11-30|2017-07-11|Bayer Cropscience Ag|pesticide and fungicide binary mixtures|

---

UA116223C2|2012-11-30|2018-02-26|Байєр Кропсайєнс Акцієнгезелльшафт|Binary fungicidal mixtures|

---

EP2925138A1|2012-11-30|2015-10-07|Bayer CropScience AG|Ternary fungicidal and pesticidal mixtures|

---

US9943082B2|2012-11-30|2018-04-17|Bayer Cropscience Ag|Ternary fungicidal mixtures|

---

JP6367214B2|2012-11-30|2018-08-01|バイエル・クロップサイエンス・アクチェンゲゼルシャフト|Two-component fungicide mixture or two-component pesticide mixture|

---

WO2014086753A2|2012-12-03|2014-06-12|Bayer Cropscience Ag|Composition comprising biological control agents|

---

WO2014086759A2|2012-12-03|2014-06-12|Bayer Cropscience Ag|Composition comprising biological control agents|

---

ES2770775T3|2012-12-03|2020-07-03|Bayer Cropscience Ag|Pest control procedure applying a combination of Paecilomyces lilacinus and Fluopyram|

---

MX2015006631A|2012-12-03|2015-08-05|Bayer Cropscience Ag|Composition comprising a biological control agent and an insecticide.|

---

JP2015535532A|2012-12-03|2015-12-14|バイエル・クロップサイエンス・アクチェンゲゼルシャフト|Composition comprising biopesticides and fungicides|

---

MX2015006500A|2012-12-03|2015-08-14|Bayer Cropsciense Ag|Composition comprising a biological control agent and a fungicide.|

---

CN105025722A|2012-12-03|2015-11-04|拜耳作物科学股份公司|Composition comprising a biological control agent and an insecticide|

---

WO2014086758A2|2012-12-03|2014-06-12|Bayer Cropscience Ag|Composition comprising a biological control agent and an insecticide|

---

WO2014090765A1|2012-12-12|2014-06-19|Bayer Cropscience Ag|Use of 1-[2-fluoro-4-methyl-5-phenyl]-5-amino-3-trifluoromethyl)-1 h-1,2,4 tfia zole for controlling nematodes in nematode-resistant crops|

---

AR093996A1|2012-12-18|2015-07-01|Bayer Cropscience Ag|BACTERICIDAL COMBINATIONS AND BINARY FUNGICIDES|

---

US9708589B2|2012-12-18|2017-07-18|Monsanto Technology Llc|Compositions and methods for custom site-specific DNA recombinases|

---

IN2015DN04206A|2012-12-19|2015-10-16|Bayer Cropscience Ag|

---

US10683505B2|2013-01-01|2020-06-16|Monsanto Technology Llc|Methods of introducing dsRNA to plant seeds for modulating gene expression|

---

US10041068B2|2013-01-01|2018-08-07|A. B. Seeds Ltd.|Isolated dsRNA molecules and methods of using same for silencing target molecules of interest|

---

US10000767B2|2013-01-28|2018-06-19|Monsanto Technology Llc|Methods and compositions for plant pest control|

---

BR112015018693A2|2013-02-11|2017-07-18|Bayer Cropscience Lp|compositions comprising a streptomyces-based biological control agent and an insecticide|

---

JP2016511245A|2013-02-11|2016-04-14|バイエル クロップサイエンス エルピーＢａｙｅｒ Ｃｒｏｐｓｃｉｅｎｃｅ Ｌｐ|Composition comprising a biocontrol agent and a fungicide based on Streptomyces|

---

WO2014124361A1|2013-02-11|2014-08-14|Bayer Cropscience Lp|Compositions comprising a streptomyces-based biological control agent and another biological control agent|

---

DK2964767T3|2013-03-07|2020-03-23|BASF Agricultural Solutions Seed US LLC|TOXICATIONS AND PROCEDURES FOR USE THEREOF|

---

EP2971185A4|2013-03-13|2017-03-08|Monsanto Technology LLC|Methods and compositions for weed control|

---

CA2905104A1|2013-03-13|2014-10-09|Monsanto Technology Llc|Control of lolium species by topical application of herbicidal composition comprising dsrna|

---

US20140283211A1|2013-03-14|2014-09-18|Monsanto Technology Llc|Methods and Compositions for Plant Pest Control|

---

US10793867B2|2013-03-15|2020-10-06|Monsanto Technology, Llc|Methods for targeted transgene-integration using custom site-specific DNA recombinases|

---

US11039586B2|2013-03-15|2021-06-22|Monsanto Technology Llc|Creation and transmission of megaloci|

---

US10568328B2|2013-03-15|2020-02-25|Monsanto Technology Llc|Methods and compositions for weed control|

---

EP2986117A1|2013-04-19|2016-02-24|Bayer CropScience Aktiengesellschaft|Binary insecticidal or pesticidal mixture|

---

CA2909725A1|2013-04-19|2014-10-23|Bayer Cropscience Aktiengesellschaft|Method for improved utilization of the production potential of transgenic plants|

---

WO2014177514A1|2013-04-30|2014-11-06|Bayer Cropscience Ag|Nematicidal n-substituted phenethylcarboxamides|

---

TW201507722A|2013-04-30|2015-03-01|Bayer Cropscience Ag|N-carboxamides as nematicides and endoparasiticides|

---

US9365863B2|2013-05-08|2016-06-14|Monsanto Technology Llc|Compositions and methods for deploying a transgenic refuge seed blend|

---

US9770022B2|2013-06-26|2017-09-26|Bayer Cropscience Ag|N-cycloalkyl-N-[methylene]-carboxamide derivatives|

---

CA2918387C|2013-07-19|2021-11-02|Monsanto Technology Llc|Compositions and methods for controlling leptinotarsa|

---

US9850496B2|2013-07-19|2017-12-26|Monsanto Technology Llc|Compositions and methods for controlling Leptinotarsa|

---

AR098295A1|2013-11-04|2016-05-26|Monsanto Technology Llc|COMPOSITIONS AND METHODS TO CONTROL INFESTATIONS OF PESTS AND PARASITES OF THE ARTHROPODS|

---

TW201607929A|2013-12-05|2016-03-01|拜耳作物科學公司|N-cycloalkyl-N-{[2- phenyl]methylene}-carboxamide derivatives|

---

AU2014359208B2|2013-12-05|2018-10-04|Bayer Cropscience Aktiengesellschaft|N-cycloalkyl-N-{[2-phenyl]methylene}-carboxamide derivatives|

---

WO2015089078A1|2013-12-10|2015-06-18|Beeologics, Inc.|Compositions and methods for virus control in varroa mite and bees|

---

EP2885970A1|2013-12-21|2015-06-24|Bayer CropScience AG|Fungicide compositions comprising compound I, at least one succinate dehydrogenaseinhibitor and at least one triazole fungicide|

---

EP3116303B1|2014-01-15|2020-07-22|Monsanto Technology LLC|Methods and compositions for weed control using epsps polynucleotides|

---

CA2942171A1|2014-03-11|2015-09-17|Bayer Cropscience Lp|Hppd variants and methods of use|

---

CN107072163A|2014-03-20|2017-08-18|孟山都技术公司|Transgenic corn events MON87419 and its application method|

---

US11091770B2|2014-04-01|2021-08-17|Monsanto Technology Llc|Compositions and methods for controlling insect pests|

---

WO2015160619A1|2014-04-16|2015-10-22|Bayer Cropscience Lp|Compositions comprising ningnanmycin and a fungicide|

---

WO2015160618A1|2014-04-16|2015-10-22|Bayer Cropscience Lp|Compositions comprising ningnanmycin and a biological control agent|

---

WO2015160620A1|2014-04-16|2015-10-22|Bayer Cropscience Lp|Compositions comprising ningnanmycin and an insecticide|

---

US10988764B2|2014-06-23|2021-04-27|Monsanto Technology Llc|Compositions and methods for regulating gene expression via RNA interference|

---

RU2021123470A|2014-07-29|2021-09-06|Монсанто Текнолоджи Ллс|COMPOSITIONS AND METHODS FOR COMBATING PESTS|

---

EP3256589B1|2015-01-22|2021-12-22|Monsanto Technology LLC|Compositions and methods for controlling leptinotarsa|

---

BR112017022000A2|2015-04-13|2018-07-03|Bayer Cropscience Ag|n-cycloalkyl-n--carboxamide derivatives.|

---

EP3097782A1|2015-05-29|2016-11-30|Bayer CropScience Aktiengesellschaft|Methods for controlling phytopathogenic nematodes by combination of fluopyram and biological control agents|

---

CN107750125A|2015-06-02|2018-03-02|孟山都技术有限公司|For by the composition and method in delivery of polynucleotides to plant|

---

EP3302030A4|2015-06-03|2019-04-24|Monsanto Technology LLC|Methods and compositions for introducing nucleic acids into plants|

---

US10575517B2|2015-06-25|2020-03-03|Accelerated Ag Technologies, Llc|Pollen field conditioning and preservation method|

---

EP3313169A1|2015-06-25|2018-05-02|Accelerated AG Technologies, LLC|Grain production|

---

EP3324732A4|2015-07-22|2019-05-15|Monsanto Technology LLC|Methods and compositions for selective regulation of protein expression|

---

CN108884470A|2015-09-11|2018-11-23|拜耳作物科学股份公司|HPPD variant and application method|

---

EP3490379A1|2016-07-29|2019-06-05|Bayer CropScience Aktiengesellschaft|Active compound combinations and methods to protect the propagation material of plants|

---

MX2019005835A|2016-11-23|2019-10-30|BASF Agricultural Solutions Seed US LLC|Axmi669 and axmi991 toxin genes and methods for their use.|

---

EP3555056A1|2016-12-19|2019-10-23|Basf Se|Substituted oxadiazoles for combating phytopathogenic fungi|

---

AR110756A1|2017-01-18|2019-05-02|Bayer Cropscience Lp|USE OF BP005 FOR PLANT PATHOGEN CONTROL|

---

EP3571303A1|2017-01-18|2019-11-27|Basf Agricultural Solutions Seed Us Llc|Bp005 toxin gene and methods for its use|

---

WO2018153730A1|2017-02-21|2018-08-30|Basf Se|Substituted oxadiazoles for combating phytopathogenic fungi|

---

US20200040313A1|2017-03-07|2020-02-06|BASF Agricultural Solutions Seed LLC|Hppd variants and methods of use|

---

WO2018175890A1|2017-03-24|2018-09-27|Accelerated Ag Technologies, Llc|Breeding methods to develop improved xenia pollinators|

---

US20200045974A1|2017-04-07|2020-02-13|Basf Se|Substituted Oxadiazoles for Combating Phytopathogenic Fungi|

---

WO2018188962A1|2017-04-11|2018-10-18|Basf Se|Substituted oxadiazoles for combating phytopathogenic fungi|

---

BR112019021938A2|2017-04-21|2020-05-05|Bayer Cropscience Lp|crop safety improvement method|

---

US20210084900A1|2017-05-04|2021-03-25|Basf Se|Substituted 5--5-hydroxy-isoxazoles for Combating Phytopathogenic Fungi|

---

WO2018202491A1|2017-05-04|2018-11-08|Basf Se|Substituted trifluoromethyloxadiazoles for combating phytopathogenic fungi|

---

WO2018219797A1|2017-06-02|2018-12-06|Basf Se|Substituted oxadiazoles for combating phytopathogenic fungi|

---

US20200190043A1|2017-06-19|2020-06-18|Basf Se|2-[[5--1,2,4-oxadiazol-3-yl]aryloxy]acetamides for combating phytopathogenic fungi|

---

WO2019025250A1|2017-08-04|2019-02-07|Basf Se|Substituted trifluoromethyloxadiazoles for combating phytopathogenic fungi|

---

WO2019038042A1|2017-08-21|2019-02-28|Basf Se|Substituted trifluoromethyloxadiazoles for combating phytopathogenic fungi|

---

BR112020004441A2|2017-09-18|2020-09-15|Basf Se|compounds of formula i, agrochemical composition, use of compounds and method of combating fungi|

---

WO2019068811A1|2017-10-06|2019-04-11|Bayer Aktiengesellschaft|Compositions comprising fluopyram and tioxazafen|

---

US20210032651A1|2017-10-24|2021-02-04|Basf Se|Improvement of herbicide tolerance to hppd inhibitors by down-regulation of putative 4-hydroxyphenylpyruvate reductases in soybean|

---

WO2019083810A1|2017-10-24|2019-05-02|Basf Se|Improvement of herbicide tolerance to 4-hydroxyphenylpyruvate dioxygenaseinhibitors by down-regulation of hppd expression in soybean|

---

BR112020008601A2|2017-11-23|2020-10-20|Basf Se|compounds, agrochemical composition, use of compounds and method to combat harmful phytopathogenic fungi|

---

WO2019121143A1|2017-12-20|2019-06-27|Basf Se|Substituted cyclopropyl derivatives|

---

WO2019137995A1|2018-01-11|2019-07-18|Basf Se|Novel pyridazine compounds for controlling invertebrate pests|

---

US20200383333A1|2018-01-29|2020-12-10|BASF Agro B.V.|New agrochemical formulations|

---

CA3086855A1|2018-02-02|2019-08-08|Monsanto Technology Llc|Maize event mon87429 and methods of use thereof|

---

WO2019154665A1|2018-02-07|2019-08-15|Basf Se|New pyridine carboxamides|

---

CN111683933A|2018-02-07|2020-09-18|巴斯夫欧洲公司|Novel pyridine carboxamides|

---

CA3090007A1|2018-02-15|2019-08-22|Monsanto Technology Llc|Improved methods for hybrid corn seed production|

---

WO2019166257A1|2018-03-01|2019-09-06|BASF Agro B.V.|Fungicidal compositions of mefentrifluconazole|

---

WO2019219464A1|2018-05-15|2019-11-21|Basf Se|Substituted trifluoromethyloxadiazoles for combating phytopathogenic fungi|

---

WO2019224092A1|2018-05-22|2019-11-28|Basf Se|Pesticidally active c15-derivatives of ginkgolides|

---

WO2019233863A1|2018-06-04|2019-12-12|Bayer Aktiengesellschaft|Herbicidally active bicyclic benzoylpyrazoles|

---

BR112021003037A2|2018-08-18|2021-05-11|Boragen, Inc.|solid forms of substituted benzoxaborol and compositions thereof|

---

EP3613736A1|2018-08-22|2020-02-26|Basf Se|Substituted glutarimide derivatives|

---

EP3628158A1|2018-09-28|2020-04-01|Basf Se|Pesticidal mixture comprising a mesoionic compound and a biopesticide|

---

EP3870581A1|2018-10-23|2021-09-01|Basf Se|Tricyclic pesticidal compounds|

---

EP3643705A1|2018-10-24|2020-04-29|Basf Se|Pesticidal compounds|

---

EP3670501A1|2018-12-17|2020-06-24|Basf Se|Substituted [1,2,4]triazole compounds as fungicides|

---

CN113272296A|2019-01-11|2021-08-17|巴斯夫欧洲公司|Crystalline forms of 1--N-ethyl-5-methyl-N-pyridazin-4-yl-pyrazole-4-carboxamide|

---

EP3696177A1|2019-02-12|2020-08-19|Basf Se|Heterocyclic compounds for the control of invertebrate pests|

---

CN109913571A|2019-04-03|2019-06-21|深圳出入境检验检疫局食品检验检疫技术中心|Transgenic corn lines MON87427 detection method and reagent|

---

WO2020231751A1|2019-05-10|2020-11-19|Bayer Cropscience Lp|Active compound combinations|

---

CN113923987A|2019-05-29|2022-01-11|巴斯夫欧洲公司|Mesoionic imidazolium compounds and derivatives for combating animal pests|

---

WO2020244970A1|2019-06-06|2020-12-10|Basf Se|New carbocyclic pyridine carboxamides|

---

AU2020286573A1|2019-06-06|2021-12-23|Basf Se|Fungicidal n-carboxamides|

---

WO2020244969A1|2019-06-06|2020-12-10|Basf Se|Pyridine derivatives and their use as fungicides|

---

EP3766879A1|2019-07-19|2021-01-20|Basf Se|Pesticidal pyrazole derivatives|

---

EP3769623A1|2019-07-22|2021-01-27|Basf Se|Mesoionic imidazolium compounds and derivatives for combating animal pests|

---

WO2021013721A1|2019-07-22|2021-01-28|Bayer Aktiengesellschaft|5-amino substituted pyrazoles and triazoles as pest control agents|

---

TW202118754A|2019-07-23|2021-05-16|德商拜耳廠股份有限公司|Novel heteroaryl-triazole compounds as pesticides|

---

WO2021013719A1|2019-07-23|2021-01-28|Bayer Aktiengesellschaft|Novel heteroaryl-triazole compounds as pesticides|

---

WO2021022069A1|2019-08-01|2021-02-04|Bayer Cropscience Lp|Method of improving cold stress tolerance and crop safety|

---

EP3701796A1|2019-08-08|2020-09-02|Bayer AG|Active compound combinations|

---

WO2021058659A1|2019-09-26|2021-04-01|Bayer Aktiengesellschaft|Rnai-mediated pest control|

---

WO2021063735A1|2019-10-02|2021-04-08|Basf Se|New bicyclic pyridine derivatives|

---

WO2021064075A1|2019-10-02|2021-04-08|Bayer Aktiengesellschaft|Active compound combinations comprising fatty acids|

---

WO2021063736A1|2019-10-02|2021-04-08|Basf Se|Bicyclic pyridine derivatives|

---

TW202128664A|2019-10-09|2021-08-01|德商拜耳廠股份有限公司|Novel heteroaryl-triazole compounds as pesticides|

---

WO2021069569A1|2019-10-09|2021-04-15|Bayer Aktiengesellschaft|Novel heteroaryl-triazole compounds as pesticides|

---

WO2021089673A1|2019-11-07|2021-05-14|Bayer Aktiengesellschaft|Substituted sulfonyl amides for controlling animal pests|

---

WO2021097162A1|2019-11-13|2021-05-20|Bayer Cropscience Lp|Beneficial combinations with paenibacillus|

---

WO2021099271A1|2019-11-18|2021-05-27|Bayer Aktiengesellschaft|Active compound combinations comprising fatty acids|

---

TW202134226A|2019-11-18|2021-09-16|德商拜耳廠股份有限公司|Novel heteroaryl-triazole compounds as pesticides|

---

TW202136248A|2019-11-25|2021-10-01|德商拜耳廠股份有限公司|Novel heteroaryl-triazole compounds as pesticides|

---

US20210238579A1|2020-01-31|2021-08-05|Pairwise Plants Services, Inc.|Suppression of shade avoidance response in plants|

---

WO2021165195A1|2020-02-18|2021-08-26|Bayer Aktiengesellschaft|Heteroaryl-triazole compounds as pesticides|

---

EP3708565A1|2020-03-04|2020-09-16|Bayer AG|Pyrimidinyloxyphenylamidines and the use thereof as fungicides|

---

CN111454874B|2020-03-06|2021-03-12|河南农业大学|Method for separating pollen of mononuclear, binuclear and mature corn and construction and application of pollen development stage judgment model|

---

WO2021211926A1|2020-04-16|2021-10-21|Pairwise Plants Services, Inc.|Methods for controlling meristem size for crop improvement|

---

WO2021209490A1|2020-04-16|2021-10-21|Bayer Aktiengesellschaft|Cyclaminephenylaminoquinolines as fungicides|

---

WO2021213978A1|2020-04-21|2021-10-28|Bayer Aktiengesellschaft|2-aryl-substituted condensed heterocyclic derivatives as pest control agents|

---

WO2021219513A1|2020-04-28|2021-11-04|Basf Se|Pesticidal compounds|

---

EP3903582A4|2020-04-28|2021-11-03|Basf Se|Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors ii|

---

EP3903581A1|2020-04-28|2021-11-03|Basf Se|Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors i|

---

EP3903583A1|2020-04-28|2021-11-03|Basf Se|Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors iii|

---

EP3903584A1|2020-04-28|2021-11-03|Basf Se|Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors iv|

---

WO2021224220A1|2020-05-06|2021-11-11|Bayer Aktiengesellschaft|Pyridine amides as fungicidal compounds|

---

WO2021224323A1|2020-05-06|2021-11-11|Bayer Aktiengesellschaft|Novel heteroaryl-triazole compounds as pesticides|

---

WO2021228734A1|2020-05-12|2021-11-18|Bayer Aktiengesellschaft|Triazine and pyrimidine amides as fungicidal compounds|

---

EP3909950A4|2020-05-13|2021-11-17|Basf Se|Heterocyclic compounds for the control of invertebrate pests|

---

WO2021233861A1|2020-05-19|2021-11-25|Bayer Aktiengesellschaft|Azabicyclicamides as fungicidal compounds|

---

WO2021247477A1|2020-06-02|2021-12-09|Pairwise Plants Services, Inc.|Methods for controlling meristem size for crop improvement|

---

WO2021245087A1|2020-06-04|2021-12-09|Bayer Aktiengesellschaft|Heterocyclyl pyrimidines and triazines as novel fungicides|

---

WO2021249800A1|2020-06-10|2021-12-16|Basf Se|Substituted [1,2,4]triazole compounds as fungicides|

---

WO2021249995A1|2020-06-10|2021-12-16|Bayer Aktiengesellschaft|Azabicyclyl-substituted heterocycles as fungicides|

---

US20210395767A1|2020-06-17|2021-12-23|Pairwise Plants Services, Inc.|Methods for controlling meristem size for crop improvement|

---

WO2021255071A1|2020-06-18|2021-12-23|Bayer Aktiengesellschaft|3--5,6-dihydro-4h-1,2,4-oxadiazine derivatives as fungicides for crop protection|

---

WO2021255118A1|2020-06-18|2021-12-23|Bayer Aktiengesellschaft|Composition for use in agriculture|

---

WO2021255169A1|2020-06-19|2021-12-23|Bayer Aktiengesellschaft|1,3,4-oxadiazole pyrimidines as fungicides|

---

WO2021255089A1|2020-06-19|2021-12-23|Bayer Aktiengesellschaft|1,3,4-oxadiazole pyrimidines and 1,3,4-oxadiazole pyridines as fungicides|

---

WO2021255091A1|2020-06-19|2021-12-23|Bayer Aktiengesellschaft|1,3,4-oxadiazoles and their derivatives as fungicides|

---

WO2021255170A1|2020-06-19|2021-12-23|Bayer Aktiengesellschaft|1,3,4-oxadiazole pyrimidines as fungicides|

---

EP3929189A4|2020-06-25|2021-12-29|Bayer Animal Health Gmbh|Novel heteroaryl-substituted pyrazine derivatives as pesticides|

---

WO2022002818A1|2020-07-02|2022-01-06|Bayer Aktiengesellschaft|Heterocyclene derivatives as pest control agents|

---

EP3939961A1|2020-07-16|2022-01-19|Basf Se|Strobilurin type compounds and their use for combating phytopathogenic fungi|

---

WO2022017836A1|2020-07-20|2022-01-27|BASF Agro B.V.|Fungicidal compositions comprising -2-[4--2-phenyl]-1- propan-2-ol|

---

EP3945089A1|2020-07-31|2022-02-02|Basf Se|Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors v|

---

WO2022033991A1|2020-08-13|2022-02-17|Bayer Aktiengesellschaft|5-amino substituted triazoles as pest control agents|

---

EP3915971A4|2020-12-16|2021-12-01|Bayer Ag|Phenyl-sn-phenylamidines and the use thereof as fungicides|

法律状态:
2018-05-02| B07A| Application suspended after technical examination (opinion) [chapter 7.1 patent gazette]|

---

2018-09-11| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|

---

2019-02-05| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2019-03-06| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 16/11/2010, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US26352609P| true| 2009-11-23|2009-11-23|

---

US26353009P| true| 2009-11-23|2009-11-23|

---

US61/263,526|2009-11-23|

---

US61/263,530|2009-11-23|

---

PCT/US2010/056853|WO2011062904A1|2009-11-23|2010-11-16|Transgenic maize event mon 87427 and the relative development scale|

---